Labshake search
Citations for Addgene :
251 - 300 of 725 citations for Alpha Cyclodextrin Solution 5% w v since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... gRNA sequences targeting Apc (5-CAACTTCTGGTAATGGTC-3) or Trp53 (5-AATGAGGCCTTGGAACTCA-3) were cloned into the Px330 vector (Addgene plasmid #42230). Organoids were removed from Matrigel using Dispase II (Gibco) ...
-
bioRxiv - Developmental Biology 2024Quote: ... gcgtgtgttcccagatgtat) and PCR donor generated with primers AP677/678 (5’Biotin::taagtgccaaggctgccaggcgtgtgttcccagaaacaccccaggaatcaacc and 5’Biotin::gtttttactcacccgatcgcctttctcaccaatacacttgtcatcgtcatccttg) on plasmid AP635 (Addgene #99485). Genotyping shows scarless insertion in the coding sequence ...
-
bioRxiv - Synthetic Biology 2023Quote: ... was PCR amplified from genomic DNA using primers (5’ CAGGTCTCAATCCCGATGTAGAACGCGAG 3’) and (5’ CGGTCTCACATATTGTTTCCTTTCTTTATTCACCGG 3’) and was cloned immediately upstream of SpCas9 amplified from plasmid PX165 (Addgene #48137) (62 ...
-
bioRxiv - Cell Biology 2023Quote: ... the primers 5’-AAACCTGGACCCCACCCCCAGATC-3’ and 5’-CACCGATCTGGGGGTGGGGTCCAG-3’ were annealed and cloned in the px458-pSpCas9(BB)-2A-GFP (Addgene, #48138) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Genomics 2023Quote: ... Guide RNAs (FANCC: 5’-GCAAGAGATGGAGAAGTGTA-3’ and MSH2: 5’-GTGCCTTTCAACAACCGGTTG-3’) were cloned into pSpCas9(BB)-2A-GFP (PX458) vector (Addgene#48138). AHH-1 cells were transfected using Lipofectamine 2000 (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2023Quote: ... The SIYx3-GFP insert was generated with the primers: 5’-GGTGTCGTGAGGATCCACCATGGTGTCTATTTACAGGTAC-3’ 5’-CGCCCTCGAGGAATTCTTACTTGTACAGCTCGTCCATGC-3’ and cloned into pLV-EF1a-IRES-Blast (Addgene #85133) linearized with BamHI and EcoRI restriction enzymes (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... mCherry-iLID was amplified using 5’-GGTAGTAGTGGTAGTAGTATGGTGAGCAAGGGCGA-3’ and 5’-TCGAAGCTTGAGCTCGAGATCTTTAAAAGTAATTTTCGTCGTTCGCT-3’.The fragments were inserted into a pEGFP-C1 vector (Addgene 46956) using the AgeI/BglII restriction sites.
-
bioRxiv - Physiology 2024Quote: ... a sgRNA was designed for exon 5 of PKHD1 (5’-3’ ACTTCCTGGAAGCATACTTC) and cloned into a pX330 plasmid (Addgene plasmid, 42230). HCD cells were transfected with the sgRNA encoding plasmid and pAcGFP1-C1 plasmid using FuGENE (Promega) ...
-
bioRxiv - Molecular Biology 2024Quote: ... a sgRNA (5’-GCTAGTGGAGAACTTGGAAA-3’) targeting the R164-allele of PCNA exon 5 was cloned into hSpCas9(BB)-2A-GFP (PX458, Addgene 48138). A double-stranded donor was constructed with a point mutation to revert the arginine (AGA ...
-
bioRxiv - Cell Biology 2024Quote: ... a FLAG-RPB1-N792D-ΔCTD fragment was PCR amplified (Forward primer: 5’ – CAATTCCACAACACTTTTGTCTTATACTTGGATCCATGGACTACAAGGACGACGATGACA - 3’; Reverse primer: 5’ – TAGGGGGGGGGGAGGGAGAGGGGCCGGCCGGGGCTCAGCTGGGAGACATGGCACCAC – 3’) from FLAG-Pol2-WT (Addgene, 35175) (55 ...
-
bioRxiv - Cell Biology 2024Quote: ... from Origene PANX1 human 29-mer shRNA kit in pRS vector (#TR302694) (sequence: 5’- CGCAATGCTACTCCTGACAAACCTTGGCATGTCAAGAGCATGCCAAGGTTTGTCAGG AGTAGCATTGTT-3’) plus a GFP shRNA cassette (5’GCCCGCAAGCTGACCCTGAAGTTCATTCAAGAGATGAACTTCAGGGTCAGCTTGCT TTTT-3’) from Addgene (#30323) as a control ...
-
bioRxiv - Developmental Biology 2024Quote: ... as well as non-targeting control gRNAs80 were synthesized with overhangs (sense: 5′-ACCG, antisense: 5′-AAAC) subcloned into the BsaI sites of pGL3-U6-sgRNA-EGFP (Addgene # 107721)81.
-
bioRxiv - Cell Biology 2020Quote: ... pLenti [CM V/GFP/Hygro] (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17446). The cut backbone vector was treated with Antarctic Phosphatase (cat# M0289S ...
-
bioRxiv - Neuroscience 2021Quote: ... The virus solution (1000 nl, titer ≥1013 vg/ml, #100836-AAV9 from Addgene) was injected in the SCN (ML +/-0.2 ...
-
bioRxiv - Cell Biology 2021Quote: ... human MCOLN1 was amplified by PCR with the following oligonucleotides with overhangs (underlined): 5’-GACACCGACTCTAGAATGGTGAGCAAGGGCGAGGAGC-3’ (forward) and 5’-AACTAGTCCGGATCCTCAATTCACCAGCAGCGAATGC-3’ (reverse) from Mucolipin1-pEGFP C3 (Addgene plasmid #62960) construct and subcloned into XbaI and BamHI restriction sites of pLenti-CMV-MCS-GFP-SV-puro (Addgene plasmid #73582 ...
-
bioRxiv - Neuroscience 2020Quote: ... each given at a total volume of 0.8 μl per hemisphere: 1) inhibitory Gi DREADD (AAV5-hSyn-hM4Di-mCherry; UNC Vector Core; n = 5; AAV8-hSyn-hM4Di-mCherry; Addgene; n = 5); excitatory Gq DREADD (AAV8-hSyn-hM3Gq-mCherry ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sgRNA pairs were manually selected from the output list and cloned into the pGECKO backbone (CRISPRi.1: 5’ GTTACTTCCAACGTACCATG 3’, CRISPRi.2: 5’ CCTGTACCCCCATGGTACGT 3’) (Addgene 78534; (68))
-
bioRxiv - Cancer Biology 2021Quote: ... by introducing one or two guide RNAs (5′-GTTGGCTCGCCGGATACGGG-3′ for H3f3b; 5′-ACTCCAGTCTTTCTAGAAGA-3′ for Rosa26) into LentiCRISPR v2 (Addgene plasmid #52961) and LentiCRISPRv2 hygro (Addgene Plasmid #98291) ...
-
bioRxiv - Neuroscience 2022Quote: ... GAD2-IRES-Cre mice were injected in the ZI with a 5:1 mix of AAV2/5-hSynapsin1-Flex-axon-GCaMP6s (Addgene, #112010-AAV5) and AAV2/9-FLEX-tdTomato (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: A sgRNA construct targeting exon 2 of the human ACLY gene was made by inserting annealed, phosphorylated oligonucleotides (5′-CACCGGAATCGGTTCAAGTATGCTC-3′, 5′-AAACGAGCATACTTGAACCGATTCC-3′) into pSpCas9(BB)-2A-Puro (PX459, Addgene, plasmid 48139). The sgRNA construct was then transfected (2 μg ...
-
bioRxiv - Microbiology 2020Quote: ... targeting ACE2 (5’-TGGATACATTTGGGCAAGTG −3’) and one targeting B4GALT7 (5’-TGACCTGCTCCCTCTCAACG-3’) was cloned into the lentiGuide-Puro plasmid (Addgene plasmid #52963) following published procedure (Sanjana et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... The fragment has been amplified using the primers F-5’-TGCAGGATCCCATCGATTCGGCCACCATGAAACGGACAG -3’ and R-5’-TAGAGGCTCGAGAGGCCTTGTCAGACTTTCCTCTTCTTCTTGG -3’) from the pCAG-CBE4max-SpG-P2A-EGFP plasmid (Addgene plasmid #139998)14 and from the pCAG-CBE4max-SpRY-P2A-EGFP plasmid (Addgene plasmid #139999)14.
-
bioRxiv - Genetics 2020Quote: ... oligonucleotides for gRNA synthesis (5’ TAGGAGGAAACTGTGCTCTTCA 3’ and 5’ AAACTGAAGAGCACAGTTTCCT 3’) were annealed and ligated into plasmid pDR274 (Addgene #44250, Watertown, MA). Purified plasmid DNA was digested with DraI (New England BioLabs ...
-
bioRxiv - Microbiology 2024Quote: The viral 5′UTR reporter constructs were synthesized using GeneArt and cloned into pLV-SARS-CoV-2 5′UTR-Luciferase (Addgene Cat#191480)32 using NdeI and BsaBI ...
-
bioRxiv - Immunology 2023Quote: ... Next the LentiGuide-Puro plasmid [49] was used to express a single-guide RNA (CD58 sgRNA; 5’-GAGCATTACAACAGCCATCG-3’ and ICAM4 sgRNA: 5’-CCGGGAACACCTGCGTCACG-3’) LentiGuide-Puro (Addgene plasmid # 52963) was a gift from Feng Zhang ...
-
bioRxiv - Cell Biology 2024Quote: ... multiple CRISPR single-guide RNAs against the sequence 5′-CAGCGGCAAGGACCAGACCG-3′ or 5′-CAGCGGCAAGGACCAGACCG-3′ were cloned into puromycin-resistant pLenti-CRISPRV2 (Addgene; Cat# 49535) which was transfected into 293TN cells with psPAX3 and pCMV-VSV-G (a gift from Jan Lammerding ...
-
bioRxiv - Molecular Biology 2024Quote: ... An 825 bp homology arm containing most of the POLQ promoter and an 800 bp homology arm containing most of POLQ exon 1 were amplified by PCR and inserted into pHD-w+ (Addgene 80927, gift from Kate O’Connor-Giles) (NEBuilder HiFi Assembly) ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV2/5-gfaABC1D-tdTomato was purchased from AddGene (44332).
-
bioRxiv - Neuroscience 2021Quote: ... AAV 2/5 hSyn-GCaMP6f was purchased from Addgene (Cat # 100837-AAV ...
-
bioRxiv - Neuroscience 2021Quote: ... with sgRNA (5’-CTTGTGGGGTCA-TGGTTTACAGG-3’) plasmid (Addgene, 68463), Cas9 plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... with 5 µg of Cas9-GFP plasmid (Addgene, 44719), 5 µg of sgRNA and 5 µg of ssDNA donor template (Table S1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5 μg of either H2B-GFP (Addgene #11680) or H2B-RFP (Addgene #26001 ...
-
bioRxiv - Systems Biology 2023Quote: ... The CRISPRi-v2 (5 sgRNA/TSS, Addgene: Cat#83969) sgRNA library was transduced into Jurkat cells at an MOI < 0.3 (BFP+ cell percentages were ∼30%) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5 µg packaging plasmid pUMVC (Addgene, Plasmid #8449). Virus particles were collected 48 h after transfection ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μg envelope helper plasmid (pMD2.G, Addgene #12259) and 80 μl of 1mg/ml polyethylenimine (PEI ...
-
bioRxiv - Neuroscience 2023Quote: ... 2.0 μl of AAV2/5.CAG.GCaMP6s.WPRE.SV40 (titer: 1X1013; Addgene) was injected into the left trigeminal ganglion (TG ...
-
bioRxiv - Neuroscience 2023Quote: ... Cre- dependent AAV2/5 hSyn.DIO.hM4D(Gi)-mCherry (Addgene; #44362) expressing the inhibitory hM4Di designer receptor exclusively activated by designer drugs (iDREADD ...
-
bioRxiv - Genetics 2023Quote: ... a fli1 P-5’entry clone (Addgene, Lawson Lab), an EGFP p-middle entry (Addgene ...
-
bioRxiv - Genetics 2023Quote: ... a fli1 P-5’entry clone (Addgene, Lawson Lab), an EGFP p-middle entry (Addgene ...
-
bioRxiv - Genetics 2023Quote: ... a fli1 P-5’entry clone (Addgene, Lawson Lab), an EGFP p-middle entry (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: 5×NF-κB_RE::RedF (#124530; Addgene, Watertown, MA, USA) is the reporter plasmid consisting of a red firefly luciferase driven by a minimal promoter containing five NF-κB-binding sites (NF-κB-Luc ...
-
bioRxiv - Immunology 2024Quote: ... and 5 µg of phCMV-VSV-G (#8454 Addgene) using calcium phosphate transfection kit (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... We first unilaterally injected a cocktail solution of pENN.AAV.CaMKII.0.4.Cre.SV40 (Addgene#105558-AAV9) and AAV2/rh8-synP-DIO-sTpEpB-WPRE-bGH with a mixed ration of 1:1 at M2 (1 μl ...
-
bioRxiv - Neuroscience 2024Quote: ... An adeno-associated virus (AAV) solution expressing jGCaMP7s under the human synapsin promoter (Addgene catalog number 104487-AAV1 ...
-
bioRxiv - Neuroscience 2024Quote: ... The APP gRNA sequence was cloned into pSpCas9 (BB)-2A-Puro (PX495) v.2.0 (plasmid #62988; Addgene, Cambridge, MA, USA) using the method described by Ran et al.48 ...
-
bioRxiv - Microbiology 2023Quote: The sgRNA for each of ITGB1 and mGluR2 were synthesized and ligated in pSpCas9(BB)-2A-Puro (PX459) V 2.0 vector (ADDGENE, UK) using BbsI restriction site ...
-
bioRxiv - Plant Biology 2020Quote: ... pICH47742::2x35S-5′UTR-hCas9 (STOP)-NOST (Addgene no. 49771), pICH41780 (Addgene no ...
-
bioRxiv - Neuroscience 2020Quote: ... the AAV2/5-gfaABC1D-tdTomato was purchased from AddGene (44332), and the AAV2/5-hSyn-hChR2(H134R)-mCherry was purchased from the UNC Vector Center ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 pmol DNA plasmids (1.5 pmol psPAX2 (Addgene #12260), 1.5 pmol pMD2.G (Addgene #12259 ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 μg VSV-G expressing envelope plasmid (pMD2.G, Addgene) and 4 μg plasmid of interest (e.g ...