Labshake search
Citations for Addgene :
101 - 150 of 725 citations for Alpha Cyclodextrin Solution 5% w v since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... The resulting construct (pHAGE-EF1aL-nlsGFP-W) with full plasmid map and sequence are available from Addgene, plasmid #126688 ...
-
bioRxiv - Genetics 2024Quote: The libraries were cloned into the lentiviral expression library pKLV2-U6gRNA5(BbsI)-ccdb-PGKpuroBFP-W (Addgene 67974)66 ...
-
bioRxiv - Neuroscience 2023Quote: ... Viral solutions (AAV9-CaMKII-somBiPOLES-mCerulean, Addgene) were loaded into beveled glass injection needles (WPI ...
-
bioRxiv - Bioengineering 2023Quote: Full length plasmid of PI3KCA (phosphatidylinositol-4,5-biphosphate 3-kinase catalytic subunit alpha, NM_006218.4) was purchased from Addgene (Plasmid ID: 81736, Hahn and Root Lab). The coding sequence of PI3KCA was cloned into Lenti-PCDH-EF1-mNeonGreen-MCS-T2A-puromycin plasmid (a kind gift from Fırat-Karalar Lab ...
-
bioRxiv - Neuroscience 2021Quote: ... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene #104964), pAAV2/6 (Addgene #110660) ...
-
bioRxiv - Molecular Biology 2022Quote: pHAGE NFkB-TA-LUC-UBC-GFP-W was a gift from Darrell Kotton (Addgene plasmid # 49343; http://n2t.net/addgene:49343 ; RRID:Addgene_49343)(Wilson et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Oligos of dual gRNAs were cloned into lentivirual vector pKLV2.2-h7SKgRNA5(SapI)-hU6gRNA5(BbsI)-PGKpuroBFP-W (#72666, Addgene). Production of gRNA particles and transduction of DM-Cas9 cells were carried out same as for shRNA ...
-
bioRxiv - Neuroscience 2023Quote: ... FU-dio PSD95-mCherry-W was a gift from Elly Nedivi (Addgene plasmid # 73919; http://n2t.net/addgene:73919; RRID:Addgene_73919)75 PSD95.FingR sequence were obtained from pCAG_PSD95.FingR-eGFP-CCR5TC and directly fused to N-terminus of Prkaca (Fig ...
-
bioRxiv - Cancer Biology 2023Quote: ... were established after transduction with a lentivirus carrying the pHAGE PGK-GFP-IRES-LUC-W plasmid (gift from Darrell Kotton, Addgene plasmid # 46793; http://n2t.net/addgene:46793; RRID:Addgene_46793), which contained the enhanced GFP and luciferase genes under the control of PGK promoter54 ...
-
bioRxiv - Cancer Biology 2022Quote: ... by cotransfecting 112.5 µg pHAGE PGK-GFP-IRES-LUC-W (a gift from Darrell Kotton (Addgene plasmid #46793;http://n2t.net/addgene:46793; RRID:Addgene_46793)) ...
-
bioRxiv - Bioengineering 2024Quote: ... Puro2ABFP-WPRE was amplified from pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W (Addgene plasmid #67974; http://n2t.net/addgene:67974; RRID:Addgene_67974) 12 by PCR using primers 3 and 4 listed in Supplementary Table 1 and cloned into the BamHI-KpnI site of pBluescript II KS (+ ...
-
bioRxiv - Cancer Biology 2024Quote: ... NEK9 or GSDME targeting Sg RNAs were cloned into pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W (Addgene, Cat No# 67974) vector according to the methods described in Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... The type V Scytonema hofmanni (Sh)CAST was obtained from Addgene (#127922) [15] ...
-
bioRxiv - Cell Biology 2023Quote: ... Lentivirus was generated by transfecting the plasmids pCMV-V-SVG (Addgene #8454), pRSV-REV (Addgene #12253) ...
-
bioRxiv - Molecular Biology 2023Quote: Constructs for shRNA targeting Primpol (5’- ATTTAGCCGACACCTAATATT) Smarcal1 (5’- CTGATTCAAGAGAAGATTAAA) and Smug1 (5’- AACTATGTGACTCGCTACT) were designed and inserted into pLKO.1neo plasmid (Addgene #13425). Lentiviruses were generated using a standard protocol (Feng and Jasin ...
-
bioRxiv - Neuroscience 2023Quote: ... The 5-HT1eR and 5-HT1FR PRESTO-Tango constructs were obtained from Addgene. For transfection ...
-
bioRxiv - Cancer Biology 2021Quote: ... two or five BoxB sites were constructed from phRL-TK-5BoxB-sp36 (a gift from W. Filipowicz; Addgene #115365) (Pillai et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... the lentiviral vector pHAGE hSPC-eGFP-W given from Darrell Kotton (Addgene plasmid # 36450; http://n2t.net/addgene:36450; RRID: Addgene_36450) was modified by inserting EF1a-promoter TagRFP cassette ...
-
bioRxiv - Cancer Biology 2021Quote: ... PTEN or non-targeting-control (see Table 3) were cloned into pLKV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W (Addgene ID:67974) and Cas9 expressing cell lines were transduced and selected with puromycin (Gibco ...
-
bioRxiv - Cancer Biology 2023Quote: ... pHAGE PGK-GFP-IRES-LUC-W was a gift from Darrell Kotton (Addgene plasmid #46793; http://n2t.net/addgene:46793; RRID: Addgene_46793). Following transduction ...
-
bioRxiv - Molecular Biology 2024Quote: ... was amplified from the 10XUAS-flp-DD plasmid (gift from Jing-W Wang; Addgene plasmid #124777; http://n2t.net/addgene:124777; RRID: Addgene_124777). The forward and reverse primers to amplify the FlpO recombinase were designed to include at the 5’ extremities the EcoRI and XmaI restriction sites ...
-
bioRxiv - Cell Biology 2020Quote: ... 5′-CAAACAATCAGCAATGCCTG-3′ and 5′-TGAAGTATTCAGAACAGAAG-3′ and cloned into pX330-P2A-EGFP (Addgene) through ligation using T4 ligase (New England Biolabs) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg pVSV (#138479, Addgene), 8 μg psPAX2 (#12260 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene Plasmid #104964), and pHelper (Cell Biolab ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μg p8.9NdeltaSB (Addgene #132929) and 0.5 μg pCMV-VSV-G (Addgene #8454) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg pRSV-Rev (Addgene 12253 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 µg pRSV-Rev (Addgene 12253 ...
-
bioRxiv - Molecular Biology 2023Quote: The control vector pEGFP was generated by Gibson assembly 106 of the following DNA fragments: the EF-1 alpha promoter (amplified from pEF1a-mRor2WT, Addgene #2261, a gift from Roel Nusse 107) and the EGFP-ori-AmpR fragment (amplified from pCMV_ABEmax_P2A_GFP ...
-
bioRxiv - Neuroscience 2022Quote: ... a virus solution (rAAV1-hSyn-jGCamP7f, 104488-AAV1, Addgene) was injected under stereotaxic conditions (400 nL ...
-
bioRxiv - Cell Biology 2020Quote: ... For combinatorial hit validation the dual CRISPR gRNA expression cassettes of pKLV2.2-h7SKgRNA5(SapI)-hU6gRNA5(BbsI)-PGKpuroBFP-W (Addgene: 72666) was cloned into the lenti-sgRNA blast plasmid to enable blasticidin selection of dual gRNA constructs ...
-
bioRxiv - Cancer Biology 2020Quote: To evaluate the NF-κB activity in the presence or absence of AF10 FPs iCALM-AF10 or iMLL-AF10 AML cells were transduced with lentivirus expressing NFkB-TA-Luc-UBC-GFP-W (Addgene plasmid 49343 ...
-
bioRxiv - Cancer Biology 2020Quote: Plasmid pHAGE NFkB-TA-LUC-UBC-GFP-W containing the luciferase gene under the minimal NF-κB promoter was a gift from Darrell Kotton (Addgene plasmid #49343 ...
-
bioRxiv - Neuroscience 2021Quote: Recombinant adeno-associated virus (AAV) vector containing a CCL2 expression cassette w as generated by replacing GFP cassette of pAAV-CAG-GFP (Addgene) with the full-length c DNA for CCL2 (OriGene) ...
-
bioRxiv - Neuroscience 2022Quote: ... flanking the Osi8 coding sequence from genomic DNA of {Act5C-Cas9.P.RFP-}ZH-2A w[118] Lig[169] flies and inserting the products into pHD-DsRed-attP (Addgene #51019) via EcoRI and SacII (HA1 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... United States (Table S1) by using E. coli Syn61Δ3(ev5) (from the laboratory of Jason W. Chin (Addgene strain #174514)) as host ...
-
bioRxiv - Cancer Biology 2023Quote: ... were established after transduction with a lentivirus carrying the pHAGE PGK-GFP-IRES-LUC-W plasmid (gift from Darrell Kotton, Addgene plasmid # 46793 ...
-
bioRxiv - Molecular Biology 2024Quote: ... were generated by lentiviral transduction of R3.8Cas9 cells with the corresponding single guide RNAs (sgRNAs) cloned in vector pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W (Addgene #67974) as previously described [26] ...
-
bioRxiv - Molecular Biology 2024Quote: ... The sequence of the destabilization domain (DD) was amplified from the 10XUAS-flp-DD plasmid (gift from Jing-W Wang; Addgene plasmid #124777 ...
-
bioRxiv - Cell Biology 2024Quote: ... scrambled and W-mut constructs for RUSH experiments were generated by amplifying ER hook from Str-ii vector (65300 - Addgene) and SBP-LiveDrop RUSH construct from a geneBlock (IDT) ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... GFP as non-human target (NHT) control (5’-GGAGCGCACCATCTTCTTCA-3’, 5’-GCCACAAGTTCAGCGTGTC-3’, and 5’-GGGCGAGGAGCTGTTCACCG-3’) cloned into pLentiCRISPRv2 (Addgene, 52961, deposited by Feng Zhang). To generate lentiviral particles ...
-
bioRxiv - Neuroscience 2020Quote: ... The Human CRISPR Libraries v.1.0 and v1.1 have been previously described (Addgene, 67989)12,42 ...
-
bioRxiv - Cell Biology 2021Quote: ... and AAV packaging plasmid expressing Rep2/Cap5 genes for production of serotype 5 – pAAV2/5 (RRID:Addgene_104964).
-
bioRxiv - Neuroscience 2024Quote: ... we obtained the AAV2/5 virus of the GFAP -tdTomato vector from Addgene (#44332-AAV2/5). Titers ranged from 1-4 x 1013 vg/mL.
-
bioRxiv - Cell Biology 2024Quote: ... The protospacer sequences are: 5′- TCTCCGCTTCTTCCGCCAGT-3′ and 5′-CCTCATCGAGGAAAAACAGG-3′ (cloned into pX459 from Addgene). CRISPRi knockdown cell lines were generated by lentiviral transduction with plasmids containing individual sgRNAs and selected by puromycin at 2 μg/mL ...
-
bioRxiv - Cancer Biology 2021Quote: Indicated cell lines were transfected using lipofectamine 3000 with 3 µg of p65 reporter plasmid (pHAGE NF-κB-TA-LUC-UBC-GFP-W plasmid from Addgene #49343). After 48h ...
-
bioRxiv - Microbiology 2020Quote: ... was constructed by cutting out the segment containing the hU6 sgRNA expression cassette and the Puro2aBFP selection marker from pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W (gift from Kosuke Yusa, Addgene # 67974) and cloning it into a PiggyBac backbone ...
-
bioRxiv - Cell Biology 2022Quote: ... was made by replacing the luciferase sequences with the fluorescent protein T-Sapphire in pHAGE NFKB-TA-LUC-UBC-dTomato-W (Addgene #49335). Additionally we replaced the marker tdTomato in Addgene #49335 with the resistance cassette for HygromycinB ...
-
bioRxiv - Physiology 2021Quote: A549 cells (NCI-DTP Cat# A549, RRID:CVCL_0023) were identically transfected with GFP-eNOS (provided by W. Sessa, Addgene plasmid #22444; RRID:Addgene_22444) and/or mCherry-HSP90 (provided by D ...
-
bioRxiv - Cancer Biology 2024Quote: ... Single clones were obtained by fluorescence-activated cell sorting and functionally tested for Cas9 activity using a lentiviral reporter pKLV2-U6gRNA5(gGFP)-PGKBFP2AGFP-W (Addgene #67980). PPM1D-mutant cell lines were generated using the RNP-based CRISPR/Cas9 delivery method using a single sgRNA (GCTAAAGCCCTGACTTTA) ...