Labshake search
Citations for Addgene :
2851 - 2900 of 3086 citations for 7' BROMO 2' 3' DIHYDRO 1'H SPIRO CYCLOPENTANE 1 4' ISOQUINOLINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... were cloned via BpiI into pX330S-2 and pX330S-3 (Sakuma et al., 2014) and a third vector pGEP179_pX330K (this study) according to kit instructions (Addgene Kit#1000000055, Sakuma et al., 2014). The pGEP179_pX330K plasmid is a modified entry vector generated by cloning the BsaI-pU6-sgRNA-BsaI fragment from pX330A-1×3 (Sakuma et ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the human codon-optimized Cas9 coding sequence including two nuclear localization signals (SV40 NLS at the 5’ and nucleoplasmin NLS at the 3’) was amplified from hCas9 (Addgene #41815; http://n2t.net/addgene:41815) using primers F_Cas9 and R_Cas9 ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells were transiently transfected with green fluorescent protein (eGFP) (0.25 µg of cDNA/ml) and PIEZO1 channel plasmid (Addgene, #80925, 3 µg of cDNA/ml). For control experiments ...
-
bioRxiv - Molecular Biology 2023Quote: The control vector pEGFP was generated by Gibson assembly 106 of the following DNA fragments: the EF-1 alpha promoter (amplified from pEF1a-mRor2WT, Addgene #2261, a gift from Roel Nusse 107) and the EGFP-ori-AmpR fragment (amplified from pCMV_ABEmax_P2A_GFP ...
-
bioRxiv - Cell Biology 2023Quote: ... U2OS cells expressing doxycycline (DOX)-activated DHFR-UBA5 were cotransfected with two plasmids: (1) pX330-U6-Chimeric BB-CBh-hSpCas9 (Addgene plasmid #42230, a gift from Feng Zhang), for expression of human codon-optimized SpCas9 and sgRNA UBA5 (ACCTACTATTGCTACGGCAA) ...
-
bioRxiv - Cell Biology 2020Quote: ... Beta-2-adrenergic receptor-CFP was a gift from Catherine Berlot (Addgene plasmid # 55794; http://n2t.net/addgene:55794; RRID:Addgene_55794) 39 ...
-
bioRxiv - Neuroscience 2022Quote: The pCMV-hEAAT2 plasmid encoding the human excitatory amino acid transporter type 2 (EAAT2) was a gift from Susan Amara (Addgene plasmid # 32814; http://n2t.net/addgene:32814; RRID:Addgene_32814). The cDNA was subcloned into pcDNA3 between KpnI and XbaI restriction sites and under the T7 promoter for expression in Xenopus laevis oocytes ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids pLVX-EF1alpha-SARS-CoV-2-proteins-2xStrep-IRES-Puro proteins are a gift from Nevan Krogan (Addgene)(Gordon ...
-
bioRxiv - Neuroscience 2021Quote: ... The SARS-CoV-2 S-6P plasmid was a gift from Jason McLellan (Addgene plasmid # 154754; http://n2t.net/addgene:154754; RRID:Addgene_154754) 30 ...
-
bioRxiv - Immunology 2021Quote: SARS CoV-2 pseudotyped lentiviruses were produced by transfecting the 293T cells with the pLenti-Puro vectors (Addgene) expressing Luciferase or β-Galactosidase ...
-
bioRxiv - Immunology 2021Quote: ... The bacterial expression construct for full-length SARS-CoV-2 nucleocapsid was a gift from Nicolas Fawzi (Addgene plasmid # 157867 ...
-
bioRxiv - Immunology 2021Quote: ... The bacterial expression construct for full-length SARS-CoV-2 nucleocapsid was a gift from Nicolas Fawzi (Addgene plasmid # 157867; http://n2t.net/addgene:157867; RRID:Addgene_157867)69 ...
-
bioRxiv - Microbiology 2021Quote: The plasmid encoding SARS-CoV-2 S HexaPro was a gift from Jason McLellan (Addgene plasmid # 154754; http://n2t.net/addgene:154754; RRID:Addgene_154754). This construct has been modified to include a cleavage site substitution as well as six prolines for stability (35) ...
-
bioRxiv - Cell Biology 2021Quote: ... These parental BV2 or BV2-Cas9 cells were transduced for 2 days with pXPR_011 expressing eGFP (Addgene; 59702) and a short guide RNA (sgRNA ...
-
bioRxiv - Neuroscience 2022Quote: ... we co-electroporated animals at stage 46-47 with pGP-CMV-GCaMP6f (2 mg/mL, Addgene plasmid # 40755) and CMV-turboRFP (1mg/ml) ...
-
bioRxiv - Cancer Biology 2022Quote: ... SCD ORF was cloned in pLenti PGK Puro DEST 5W(w529-2) (gift from Eric Campeau & Paul Kaufman73; Addgene plasmid #19068; http://n2t.net/addgene:19068 ; RRID:Addgene_19068). FLT3-WT and FLT3-ITD ORFs were cloned in pLEX_307 (gift from David Root (Addgene plasmid #41392 ...
-
bioRxiv - Neuroscience 2020Quote: ... for imaging hippocampal pyramidal cells or pAAV-mDlx-GCaMP6f-Fishell-2 (a gift from Gordon Fishell, Addgene plasmid # 83899; http://n2t.net/addgene:83899; RRID:Addgene_83899) (88 ...
-
bioRxiv - Microbiology 2021Quote: ... and pLenti CMV GFP Neo (657-2) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17447). Expression plasmids SARS2-S2’-AA ...
-
bioRxiv - Neuroscience 2021Quote: ... The pCMV14-3X-Flag-SARS-CoV-2 S plasmid was a gift from Zhaohui Qian (Addgene plasmid # 145780; http://n2t.net/addgene:145780; RRID:Addgene_145780) 38 ...
-
bioRxiv - Immunology 2020Quote: ... The vector pEQ276 (encoding CMV IE1 and 2 genes) was a gift from Adam Geballe (Addgene plasmid #83945)67 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Streptomyces pyogenes (sp) guide RNA sequences (Table 2) were cloned into the LentiGuide-Puro plasmid (plasmid #52963, Addgene). lentiGuide-Puro was a gift from Feng Zhang (Addgene plasmid # 52963 ...
-
bioRxiv - Cell Biology 2019Quote: ... we designed sgRNAs targeting exon 2 using CHOPCHOP (http://chopchop.cbu.uib.no/index.php) and cloned these sequences into lentiguide-puro (Addgene, cat. 52962). All lentiviruses were prepared by cotransfecting HEK293T cells with the lentivector ...
-
bioRxiv - Neuroscience 2021Quote: ... mEos3.2-Homer1-N-18 was a gift from Michael Davidson (Addgene plasmid # 57461 ; http://n2t.net/addgene:57461; RRID:Addgene_57461). CMV::SypHy A4 was a gift from Leon Lagnado (Addgene plasmid # 24478 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 μg of total plasmid DNA/well were used in appropriate combinations of the plasmids: pLVX-puro (Addgene), pLVX-puro-TRIM67-Flag ...
-
bioRxiv - Genomics 2020Quote: FUS-/- cells were generated by transient transfection of U-2 OS cells with pX459 (v2, Addgene plasmid #62988) vectors(Ran et al. ...
-
bioRxiv - Biophysics 2019Quote: ... SUM-159 cells genome edited to express σ2-EGFP [2] and transiently expressing mRuby-CLTB (Addgene; Plasmid #55852) were cultured in F-12 medium with hydrocortisone ...
-
bioRxiv - Immunology 2020Quote: ... pGBW-m4134096 encoding for SARS-CoV-2 M protein was a gift from Ginkgo Bioworks (Addgene plasmid #152039).
-
bioRxiv - Cell Biology 2022Quote: ... pEGFP-ZO-2 was a gift from Marius Sudol (Addgene plasmid # 27422; http://n2t.net/addgene: 27422; RRID: Addgene_27422) (Oka et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... YAP–HaloTag CRISPR knock-in U-2 OS cells were transfected with pEGFP-C3-Lats1 (Addgene plasmid # 19053) or pEGFP C3-Mst2 (Addgene plasmid # 19056) ...
-
bioRxiv - Microbiology 2022Quote: ... pGBW-m4252984 (SARS-CoV-2 E [envelope]) was a gift from Ginkgo Bioworks (Addgene plasmid #153898; http://n2t.net/addgene:153898; RRID:Addgene_153898). MLV-gag/pol ...
-
bioRxiv - Molecular Biology 2022Quote: All engineered SARS-CoV-2 S variant ectodomains were designed based on the HexaPro gene (Addgene plasmid #154754) containing stabilizing proline mutations at positions F817P ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were transfected with either (G4C2)92 and (G4C2)2 lentiviral transfer plasmids along with PAX (Addgene #12260) and VSV-G (Addgene #12259 ...
-
bioRxiv - Microbiology 2024Quote: ... The plasmid pcDNA3.1 SARS-CoV-2 S D614G was a gift from Jeremy Luban (Addgene plasmid # 158075; http://n2t.net/addgene:158075; RRID:Addgene_158075). The RBD amino acid sequence 328-537 encoded in this plasmid is identical to the sequence of RBD that we studied here ...
-
bioRxiv - Immunology 2024Quote: ... The plasmid pcDNA3.1 SARS-CoV-2 S D614G was a gift from Jeremy Luban (Addgene plasmid # 158075; http://n2t.net/addgene:158075; RRID:Addgene_158075). The RBD amino acid sequence 328-537 encoded in this plasmid is identical to the sequence of RBD that we studied here ...
-
bioRxiv - Biochemistry 2024Quote: ... and T7 Ocr (NCBI Accession # NP_041954.1) genes were cloned into UC Berkeley Macrolab vectors 2-BT (Addgene #29666) and 13S-A (Addgene #48323 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV-mDlx-GCaMP6f-Fishell-2 was a gift from Gordon Fishell (Addgene plasmid # 83899-AAV1; http://n2t.net/addgene:83899; RRID:Addgene_83899), was infected in 4 DIV neurons and imaged 12-13 DIV inhibitory interneurons ...
-
bioRxiv - Cancer Biology 2022Quote: ... pENTR4-FLAG (w210-2) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17423 ; http://n2t.net/addgene:17423 ; RRID:Addgene_17423), pGP (retroviral Pol and Rev gene plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... rats received 2 separate unilateral microinjections (males 0.2 µL, females 0.15 µL) of retrograde-transported AAV (AAVretro) constructs (Addgene) in the RVLM and CVLM (RVLM-males ...
-
bioRxiv - Cell Biology 2023Quote: ... UGGT2-/- and UGGT1/2-/-HEK 293T cells were generated using the CRISPR/Cas9 system from Addgene (http://www.addgene.org/). The sequences for guide RNAs were obtained from http://tools.genome-engineering.org and https://www.addgene.org/pooled-library/zhang-human-gecko-v2/ ...
-
bioRxiv - Cell Biology 2023Quote: Day 5 moDCs previously transfected with either NT or gal9 siRNA were transfected with 2 ug of the Str-KDEL_TNFα_SBP_EGFP plasmid (Addgene, #65278) (Boncompain et al ...
-
bioRxiv - Biochemistry 2023Quote: ... P05771-2) was a gift from William Hahn & David Root (Addgene plasmid #23746; http://n2t.net/addgene: 23746; RRID:Addgene_23746) (Johannessen et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pWPXLd-OGT-GFP fusion vector was described in our previous articles,(2) pET24a-ncOGT-FL (190821, Addgene), other plasmids were cloned into pcDNA3.1 backbone with c-myc or HA tag ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Gentamicin-R and Kanamycin-R) were made electrocompetent using our standard protocol2 and electroporated with pORTMAGE-2 (Addgene plasmid # 72677 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... were made electrocompetent using our standard protocol2 and electroporated with pORTMAGE-2 (Addgene plasmid # 72677; http://n2t.net/addgene:72677; RRID:Addgene_72677) or alternatively ...
-
bioRxiv - Cancer Biology 2024Quote: HEK293 cells were cultured in 6-well plates and then transfected with 4 μg of previously described plasmid vectors encoding ER stress reporter genes ATF4-mS (#115970, Addgene, Cambridge, MA, USA), XBP1-mN (#115971) ...
-
bioRxiv - Bioengineering 2023Quote: ... we followed the protocol of our previous study20 to transfected 6 individually isolated fibroblast lines with 4 μg of episomal plasmid (#58527; Addgene, Watertown, MA, USA) using the NucleofectorTM II with the A-024 program (Amaxa ...
-
bioRxiv - Developmental Biology 2021Quote: ... using program A-30 with 1.6 µg each of GFP and tdTomato circularised targeting vectors and 5 µg single gRNA vector PX459 (5’-TATACCTAATCATTATGCCG-3’) (Addgene, 48139, a gift from Feng Zhang). Homology arms flanking the target site were amplified from genomic DNA and cloned into pBluescript II SK(+ ...
-
bioRxiv - Cell Biology 2022Quote: ... IFT121 and IFT139 in IMCD-3 cells were designed using Benchling software and cloned into the pX330 vector (gift from Feng Zhang; Addgene plasmid # 42230; (Cong et al., 2013)) ...
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and our previously verified sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN120 from pLentiCRISPRv2 (Addgene #52961; a gift from Feng Zhang) via lentiviral transduction ...
-
bioRxiv - Cancer Biology 2023Quote: ... The alleles also contain mutations that confer resistance to CRISPR/Cas9 editing (without changing the amino acid sequence) with all the sgRNAs against LKB1 in the Toronto Knockout version 3 (TKOv3) CRISPR library (Addgene 125517, a gift from Jason Moffat). These alleles were then cloned into pBABE-GFP (Addgene 10668 ...