Labshake search
Citations for Addgene :
2551 - 2600 of 3086 citations for 7' BROMO 2' 3' DIHYDRO 1'H SPIRO CYCLOPENTANE 1 4' ISOQUINOLINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... The SARS-CoV-2 S-6P plasmid was a gift from Jason McLellan (Addgene plasmid # 154754 ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2 μg of viral entry protein VSV-G plasmid pMD2.G (Addgene; 12259) were mixed into 600 μl of serum-free DMEM ...
-
bioRxiv - Genomics 2020Quote: ... pCFJ90 - Pmyo-2∷mCherry∷unc-54utr (Addgene plasmid # 19327; http://n2t.net/addgene:19327; RRID:Addgene_19327), pCFJ104 - Pmyo-3∷mCherry∷unc-54 (Addgene plasmid # 19328 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2) EF1α promoter and puro resistance gene were amplified from lentiGuide-Puro (Addgene #52963). 3 ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA of SKAP2WT and SKAP2W336K (see Table 2) was transferred into pLEX_307 (Addgene #41392). For analysis of subcellular localization ...
-
bioRxiv - Microbiology 2021Quote: ... The pCRISPomyces-2 vector used in this study was obtained from Addgene (Code: 617374). All the media and chemicals were used in this study were purchased from Hi-media (Mumbai-India ...
-
bioRxiv - Microbiology 2021Quote: The Plasmid expressing SARS CoV-2 Spike protein (Wuhan isolate) was procured from Addgene with 19 nineteen amino acids deletion at C- terminal that enables efficient lentiviral packaging ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2×106 cells were co-transfected with Cas9 (pU6_CBh-Cas9-T2A-BFP: Addgene #64323) and gRNA (pSPgRNA ...
-
bioRxiv - Neuroscience 2022Quote: ... psiCHECK-2-Sal4-wt_3’UTR was a gift from Robert Blelloch (Addgene plasmid # 31862). psiCHECK-2-Rab GTPases were generated by inserting Rab GTPases into psiCHECK- 2-Sal4-wt_3’UTR by XhoI/NotI.Tetanus toxin light chain (Eisel et al. ...
-
bioRxiv - Microbiology 2022Quote: ... pGBW-m4252984 (SARS-CoV-2 E [envelope]) was a gift from Ginkgo Bioworks (Addgene plasmid #153898 ...
-
bioRxiv - Neuroscience 2022Quote: ... All AAV plasmids presented in this study are available from Addgene (Supplementary Table 2).
-
bioRxiv - Developmental Biology 2021Quote: ... and 8×105 cells were electroporated with 2 μg Cas9-sgRNA plasmid (Addgene: #48139), 1 µg pEGFP-Puro and 200μM (6.6 μg ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 gRNA plasmids were generated per construct and were integrated into pX330 (Addgene# 42230) using BbsI site as previously described 16 ...
-
bioRxiv - Molecular Biology 2019Quote: ... HA-SUMO-2 WT plasmid was a gift from Guy Salvesen (Addgene plasmid # 48967). Flag-PIAS4 WT plasmid was a gift from Ke Shuai (Addgene plasmid # 15208) ...
-
bioRxiv - Neuroscience 2019Quote: ... astrocytes were transfected with 2 μg of pLYS1-FLAG-MitoGFP-HA (Addgene plasmid # 50057) which contains the pore-forming subunit of the mitochondrial calcium uniporter coupled to GFP or a mito-mCherry construct generated by subcloning the targeting sequence of the pLYS1-FLAG-MitoGFP-HA plasmid into the mcherry2-N1 vector (Addgene plasmid # 54517) ...
-
bioRxiv - Immunology 2021Quote: The mammalian expression plasmid containing SARS-CoV-2 HexaPro spike was obtained from Addgene (Addgene plasmid # 154754 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2) the NLS-Cas9 gene from the pHsp70 Cas9 plasmid (Addgene plasmid #46294 (32)) connected to the promoters and 3’-UTRs from the β2tubulin (AAEL019894) ...
-
bioRxiv - Molecular Biology 2022Quote: ... HeLa cells (ATCCCCL-2) were transiently transfected with SpCas9-expressing PX459 plasmid (Addgene # 62988) using Lipofectamine 2000 (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV vectors expressing ChrimsonR (pAAV1-Syn-ChrimsonR-tdT; 2 × 10^13 GC/ml; Addgene) 27 or channelrhodopsin-2 (hChR2 ...
-
bioRxiv - Neuroscience 2022Quote: ... we first cloned 2 single guide RNAs (sgRNAs) into a pCFD5 plasmid (Addgene #73914): sgRNA1 atcgtccggcagccagcgttcgg (189bp upstream of the start codon ...
-
bioRxiv - Neuroscience 2023Quote: ... bolus injections of either AAV serotype 9 or 2 were (Addgene, Watertown, MA, USA) delivered and followed by a flush of 200 μL of sterile saline ...
-
bioRxiv - Molecular Biology 2023Quote: ... two different gRNAs for SETD6 (Table 2) were cloned into lentiCRISPR plasmid (Addgene, #49535). Following transduction and puromycin selection (2.5 µg/ml) ...
-
bioRxiv - Microbiology 2023Quote: ... Shedu-ΔNL constructs were cloned into UC Berkeley Macrolab vector 2-BT (Addgene #29666), which encodes an N-terminal TEV protease-cleavable His6 tag.
-
bioRxiv - Cell Biology 2023Quote: ... elegans cDNA library and cloned into UC Berkeley Macrolab vector 2-CT (Addgene #29706), which encodes a TEV protease-cleavable His6-MBP (maltose binding protein ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding ancestral and variant SARS-CoV-2 spike protein were purchased from Addgene (170442 ...
-
bioRxiv - Microbiology 2023Quote: SARS-CoV-2 S HexaPro was a gift from Jason McLellan (Addgene plasmid #154754) 21 ...
-
The HUSH epigenetic repressor complex silences PML nuclear bodies-associated HSV-1 quiescent genomesbioRxiv - Microbiology 2024Quote: ... plasmids of interest (see plasmids section) were co-transfected with psPAX.2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Neuroscience 2024Quote: ... For calcium imaging an AAV was injected (AAV1.Syn.GCaMP6m.WPRE.SV40; RRID: Addgene_100841, titre: 2*1012) into the PPC (from Bregma ...
-
bioRxiv - Immunology 2024Quote: ... The wild-type SARS-CoV-2 spike plasmid (HDM-SARS2-spike-delta21, Addgene #155130) was cloned with the additional D614G substitution ...
-
bioRxiv - Molecular Biology 2024Quote: ... Vector for CRISPR/Cas9-mediated knock-out of BCL-2 was plentiCTRSPRv2 (Addgene #52961) with gRNA targeting exon 1 in BCL2 ...
-
bioRxiv - Immunology 2024Quote: ... gRNA#2: ATGTTGGCTAGCTGTCGATT (Exon2 ORF bp196-215) and cloned into lentiCRISPRv1 (Addgene, plasmid 49535). After lentiviral transduction using lentiCRISPRv1 as control as described below ...
-
bioRxiv - Cancer Biology 2021Quote: Indicated cell lines were transfected using lipofectamine 3000 with 3 µg of p65 reporter plasmid (pHAGE NF-κB-TA-LUC-UBC-GFP-W plasmid from Addgene #49343). After 48h ...
-
bioRxiv - Cell Biology 2020Quote: ... A template vector which carries full-length AID-3 × FLAG-P2A-BSD was produced with the backbone of pMK392 (Addgene, 121193). Full-length AID-3×FLAG-P2A-BSD was integrated into the site just before the terminal codon of the sub-cloned CENP-E gene ...
-
bioRxiv - Genetics 2021Quote: mks-3::gfp transgenes were generated with PCR-based fusion of mks-3 gDNA (including 485 bp of 5’ UTR sequence) with GFP (pPD95_77, gift from Andrew Fire, Addgene plasmid #1495). All primers are listed in Table S4 ...
-
bioRxiv - Genetics 2021Quote: ... hermaphrodites were injected with 0.25ng/μl mks-3::gfp and 100ng/μl coel::dsRed (gift from Piali Sengupta, Addgene plasmid #8938) to generate extrachromosomal arrays (1-7 lines each) ...
-
bioRxiv - Genetics 2020Quote: Flies expressing a gRNA targeting the rosy (ry) locus (5’-CATTGTGGCGGAGATCTCGA-3’) were generated by cloning the gRNA sequence into the pCFD3 plasmid (Addgene #49410) as in [44] ...
-
bioRxiv - Developmental Biology 2020Quote: The LV-MiniP-H2B-GFP vectors were prepared by inserting the respective MimiP sequences (24) into the LV-H2B-GFP vector (3) (Addgene, #25999) using PCR introduced SalI ...
-
bioRxiv - Molecular Biology 2021Quote: ... For the generation of the double K73E K80E (2KE) sov mutant two guides (Supplementary Table 3) were cloned into pDCC6 (Addgene 59985) and co-injected with an AltR HDR donor oligo (IDT ...
-
bioRxiv - Genomics 2020Quote: ... The INTS6 ORF was PCR amplified with 5’ Xho I and 3’ EcoRI restriction site overhangs and the coding sequence for a C-terminal V5 epitope tag was added in frame to the 3’ end of the INTS6 ORF (Key Resources Table. The INTS6 PCR product and MSCVpuro vector (Addgene 68469) were digested with XhoI (NEB R0146 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5’–CACCTTTGCCACTCTCAAAGGGGA-3’ and sgRNA REV: 5’-AAACTCCCCTTTGAGAGTGGCAAA-3’) was cloned into a BbsI digested pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (42230; Addgene, Cambridge MA). Template DNA for in vitro transcription was generated by PCR amplification of the gRNA sequence—which included both the guide sequence as well as the scaffold sequence encoded in the pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid—using Phusion HF DNA polymerase and a primer set (synthesized by IDT ...
-
bioRxiv - Genetics 2021Quote: ... Putative enhancers were attached to a pes-10 minimal promoter::HIS-24::mCherry::let-858 3’UTR fragment amplified from POPTOP plasmid (71) (Addgene #34848) by using PCR stitching to create an enhancer reporter which was sequence verified and purified with a PureLink PCR purification kit (ThermoFisher ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA sequence (5’-GCCCAATTCAGAGAGACATG-3’) targeting the genomic region immediately downstream the CDK12 start codon was cloned into the PX458 vector (Addgene 48138). The 3xFLAG knock-in repair template was constructed in a pTOPO-TA vector (Mei5bio ...
-
bioRxiv - Cell Biology 2021Quote: ... The UAS sites and K10 3’UTR were replaced via PCR with the squash promoter and squash 3’UTR from pBS-Squ-mCherry (Eric Wieschaus56, Addgene 20163). The RhoGEF2 ORF was obtained from the DGRC (SD04476) ...
-
bioRxiv - Cell Biology 2021Quote: A gRNA targeting the second exon of mouse Tubb6 gene (5’-CGACCAGGCCGGAGGCTACG-3’) was designed and cloned in lentiCRISPRv2 (Addgene, 52961). Empty and Tubb6 gRNA-containing lentiCRISPRv2 were used to produce lentiviruses ...
-
bioRxiv - Neuroscience 2020Quote: ... targeting exon 3 of the Prnp gene (5′-TCA GTC ATC ATG GCG AAC CT −3′) was cloned into the pKLV-U6gRNA(BbsI)-PGKpuro2ABFP vector (Addgene 50946,) to generate pKLV-Prnp sgRNA plasmid ...
-
bioRxiv - Neuroscience 2019Quote: ... Oligo nucleotides containing CRISPR target sequences (5’-CCGGCCGGGCCTACGGCTTG-3’) were annealed and ligated into pSpCas9 (BB)-2A-GFP (PX458) (Addgene 48138). Then ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR products were used as templates for final PCR using 5’ GGGGTACCGAA GTAAAACTTTAACTTCA G 3’ and 5’ CCGCTCGAGCTAATGATGATGATGATGATGC AATCCCCGAGACTTGTA C 3’ primer pair (KpnI and XhoI sites are underlined respectively) and cloned into pIB3 vector (cat # 25452, Addgene, USA). Similar strategy was used for PGAPDH-PEPCKDPRPEPCKMyc construct generation ...
-
bioRxiv - Cell Biology 2021Quote: ... The sgRNA (100 ng/μl) and SEC repair template (20 ng/μl) plasmids combined with Peft-3::Cas9 (60 ng/μl; Addgene #46168) and Pmyo-2::mCherry co-injection marker (2.5 ng/μl ...
-
bioRxiv - Cell Biology 2021Quote: ... the rps-0 promoter and the unc-54 3’ UTR fragments were combined and inserted into the pMLS257 plasmid (Addgene #73716) using the SapTrap assembly method (Schwartz and Jorgensen ...
-
bioRxiv - Cell Biology 2021Quote: ... Expression vectors for NFAT4 D-site variants were prepared by subcloning residues 3 – 407 of WT NFAT4 from the corresponding mammalian expression vector (Addgene #21664) into pGEX4T1 ...