Labshake search
Citations for Addgene :
2801 - 2850 of 3086 citations for 7' BROMO 2' 3' DIHYDRO 1'H SPIRO CYCLOPENTANE 1 4' ISOQUINOLINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... The hDLXI56i enhancer was originally obtained from CN1851-rAAV-hI56i-minBglobin-iCre-4×2C-WPRE3-BGHpA (Graybuck et al., 2021) (Addgene #164450).
-
bioRxiv - Cancer Biology 2023Quote: ... they were transduced with lentivirus containing pLenti_CMV_GFP_Hygro [pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene viral prep #17446-LV)] at a multiplicity of infection of 10 for 48 hours before washing with PBS and replacing with fresh medium ...
-
bioRxiv - Molecular Biology 2024Quote: ... The sensing domain for citrate comprised residues 4–133 of the CitAP domain from Klebsiella pneumoniae CitA protein (Addgene plasmid #134301). The sensing domain for glucose comprised residues 24–328 of the bacterial D-galactose-binding periplasmic protein (MglB ...
-
bioRxiv - Developmental Biology 2019Quote: ... Injection mixes with a total volume of 50 μl were prepared in milliQ H2O and contained a combination of 30-50 ng/μl Peft-3::cas9 (46168; Addgene; Friedland et al., 2013), 50-100 ng/μl Pu6::sgRNA with sequences targeted against pop-1 or rnt-1 ...
-
bioRxiv - Immunology 2020Quote: ... devil NLRC5 was amplified from pAF105 with overlapping ends to the 5’ and 3’ SfiI sites of the Sleeping Beauty transposon plasmid pSBbi-BH42 (a gift from Eric Kowarz; Addgene # 60515, Cambridge, MA, USA) using Q5® Hotstart High-Fidelity 2X Master Mix (New England Biolabs (NEB) ...
-
bioRxiv - Molecular Biology 2019Quote: ... we designed and generated a CRISPR plasmid targeting the 5′– GTTTGCCCATTACTCTT/CAT(PAM:AGG)–3′ sequence using pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42260, gift from Dr. Feng Zhang), according to a published protocol (Ran et al ...
-
bioRxiv - Neuroscience 2022Quote: ... A pulled glass pipette attached to a 10μl Hamilton syringe was backfilled with a solution containing a viral construct carrying gCaMP7f (AAV1-syn-jGCaMP7f-WPRE, titer 3×1013 gc/mL Addgene cat no 104488-AAV1). To reach the appropriate titer ...
-
bioRxiv - Bioengineering 2024Quote: ... Double-cysteine substitution variants of DoubleCatcher were derived from pDEST14-SpyCatcher003-(GSG)3-SpyCatcher003-TEVs-SpyTag003DA by Gibson assembly: DoubleCatcher α-Lock (GenBank and Addgene deposition in progress), DoubleCatcher β-Lock (GenBank and Addgene deposition in progress) ...
-
bioRxiv - Bioengineering 2023Quote: Full length plasmid of PI3KCA (phosphatidylinositol-4,5-biphosphate 3-kinase catalytic subunit alpha, NM_006218.4) was purchased from Addgene (Plasmid ID: 81736, Hahn and Root Lab). The coding sequence of PI3KCA was cloned into Lenti-PCDH-EF1-mNeonGreen-MCS-T2A-puromycin plasmid (a kind gift from Fırat-Karalar Lab ...
-
bioRxiv - Immunology 2021Quote: ... the human CRISPR 2-plasmid activation pooled library (SAM) was a gift from Feng Zhang (Addgene #1000000078) and used for CRISPR activation screening ...
-
bioRxiv - Synthetic Biology 2020Quote: ... targeting the LMNB1 gene (GGGGTCGCAGTCGCCATGGC) (2 ug) and an LMNB1-mEGFP containing repair vector (Addgene plasmid #87422) (3 μg ...
-
bioRxiv - Microbiology 2021Quote: ... The SARS-CoV-2 S-mEmerald construct was made by cloning the mEmerald sequence (Addgene, Plasmid #53976) to the C-terminal end of the SARS CoV-2 S-protein in the pCG expression vector ...
-
bioRxiv - Neuroscience 2020Quote: kn-p65AD was generated by co-injecting pBS-KS-attB2-SA(2)-T2A-p65AD-Hsp70 (Addgene #62915) and ΦC31 into the embryos of MI15480 (BL61064) ...
-
bioRxiv - Cancer Biology 2021Quote: Guide RNAs for TP53 and SETD2 were constructed and cloned into lenti CRISPR v-2 (Addgene, 52961) according to the original online protocol of the Zhang lab (http://www.genome-engineering.org/crispr/wp-content/uploads/2014/05/CRISPR-Reagent-Description-Rev20140509.pdf) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and 0.5 μg of SARS-CoV-2 Spike plasmid (a gift from Fang Li, Addgene plasmid #145032) using Lipofectamine 3000 transfection reagent (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... Retroviruses were generated by co-transfection of viral vectors (2 μg) with pCMV-VSVG (0.25 μg) (Addgene) into Phoenix-gp cells with 90% confluency in a 6-well plate ...
-
bioRxiv - Microbiology 2022Quote: ... and are also available on Addgene (pLVX-EF1alpha-SARS-CoV-2-nsp14-2xStrep-IRES-Puro, Addgene #141380). Nsp10-Flag plasmid was a gift from the Ott lab.
-
bioRxiv - Biophysics 2022Quote: ... These cells (1.5 × 106) were transfected with 2 μg of plasmid encoding eGFP-Cre recombinase (Addgene # 11923), a gift from Brian Sauer (Le et al. ...
-
bioRxiv - Immunology 2022Quote: ... the SARS-CoV-2 S HexaPro plasmid was a generous gift from Jason McLellan (Addgene plasmid # 154754) (19) ...
-
bioRxiv - Neuroscience 2020Quote: ... for imaging hippocampal pyramidal cells or pAAV-mDlx-GCaMP6f-Fishell-2 (a gift from Gordon Fishell, Addgene plasmid # 83899 ...
-
bioRxiv - Neuroscience 2021Quote: ... mice received 50 nL of helper AAV2/8 syn.dio.TVA.2A.GFP.2A.B19G (UNC vector core) followed 2 weeks later by 300nl of rabies SAD.B19.EnvA.ΔG.mCherry (SAD-B19 strain, Addgene Cat# 32636 prepared by the Salk institute vector core ...
-
bioRxiv - Neuroscience 2022Quote: ... and SNORD115 were designed using MIT’s CRISPR Design Tool (http://crispr.mit.edu; Supplemental Table 2) and cloned into pX459v2.0 (Addgene 62988) vector ...
-
bioRxiv - Cancer Biology 2020Quote: ... or with 2 μg/ml puromycin (Gibco) (pTK93_Lifeact-mCherry; a gift from Iain Cheeseman, Addgene plasmid #46357) for 3 days ...
-
bioRxiv - Immunology 2021Quote: Plasmid pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian (Addgene plasmid # 145780)68 ...
-
bioRxiv - Microbiology 2022Quote: ... UL123 was also cloned into pLVX-EF1alpha-SARS-CoV-2-nsp1-2XStrep-IRES-Puro (Addgene plasmid #141367) in place of the SARS-CoV-2-nsp1-2XStrep cassette ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli codon optimized SARS-CoV-2 genes from plasmid vectors synthesized by GinkoBioworks and distributed by Addgene. Amplified genes were digested with NdeI and SacI ...
-
bioRxiv - Physiology 2022Quote: ... The pTwist-EF1a carrying the SARS-CoV-2 E protein with 2xSTREP tags were obtained from Addgene. pCMV-rpHluorin-N1 was a kind gift from Dr ...
-
bioRxiv - Molecular Biology 2024Quote: The plasmid pLVX-EF1alpha-SARS-CoV-2-orf6-2xStrep-IRES-Puro (Addgene plasmid #141387 from Nevan Krogan) [12] was used for the overexpression of the accessory proteins ORF6 ...
-
bioRxiv - Microbiology 2023Quote: ... along with a luciferase gene with SARS-CoV-2 packaging sequence PS9 into 293T cells (Addgene 177942). Plasmids were gifts from Jennifer Doudna ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids encoding HCoV-229E and SARS-CoV-2 N proteins were obtained from Addgene (#151912 and #141391). C-terminally FLAG-tagged 229E N and SARS-CoV-2 N constructs were cloned into pcDNA3.1 using specific primer sequences (Supplementary Table S1).
-
bioRxiv - Immunology 2023Quote: ... the SARS-CoV-2 S 6P expression vector was a gift from Jason McLellan (Addgene plasmid #154754). The secreted protein was captured by Strep-Tactin affinity chromatography ...
-
bioRxiv - Biophysics 2023Quote: ... pCAGGS-SARS-CoV-2 S D614G (# 156421) and pcDNA3.1 vectors were obtained from Addgene (Watertown, MA, USA), and Invitrogen (Waltham ...
-
bioRxiv - Biochemistry 2023Quote: ... The pDONR223-PRKCB2 (PKCβII, uniprot identifier: P05771-2) was a gift from William Hahn & David Root (Addgene plasmid #23746 ...
-
bioRxiv - Biochemistry 2023Quote: The coding sequence for α-actinin-2-ABD was obtained from Addgene (RefSeq: NM_001103.3, Plasmid ID 52669) and PCR amplified using the forward primer AAACACCTGCAAAAAGGTATGAACCAGATAGAGCCCGGC and reverse primer AAATCTAGATTACTCCGCGCCCGCAAAAGCGTG ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and pCOLA-Gent-EM7-Erv1p-PDI were both cloned with 2 fragment gibson assemblies (Addgene Cat#202486). For each assembly ...
-
bioRxiv - Developmental Biology 2023Quote: ... tbb-2 sequence was amplified using primers RA1792 and RA1793 and cloned into pPD95.75 (Addgene plasmid #1494) digested with EcoRI and SpeI using the NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Plant Biology 2024Quote: ... and pICH51288 and pICH41414 (2×35S and 35S terminator; Addgene #50269 and #50337; Engler et al., 2014) in a BsaI Golden Gate reaction to generate binary vectors containing the fragment-swapped Rcr3/Pip1 hybrids driven by the double 35S CaMV promoter and targeted to the apoplast using a NtPR1a signal peptide ...
-
bioRxiv - Immunology 2024Quote: pcDNA3.1 plasmids encoding the C9-tagged SARS-CoV-2 S protein (pcDNA3.1-SARS2-S) (Addgene plasmid # 145032)62 ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNAs were amplified from the corresponding pJet1.2 vectors and pPD95.81 (a gift from Andrew Fire (Addgene plasmid # 1497; http://n2t.net/addgene:1497; RRID:Addgene_1497)) was a source of backbone and GFP sequences ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 million HeLa cells were resuspended in 400 μL DMEM with 2 μg SpCas9 plasmid (Addgene, 71814), 500 ng gRNA plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... Single-cell clone parental cells were transfected with pSpCas9(BB)-2A-Puro 2 (Addgene Cat No. 48139) that contain guide RNAs that target the intron-exon junction of the second exon of HMCES (5’-TTGCGCCTACCAGGATCGGC and 5’-ACTTTAGACGGTGGTCACGG) ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 μg of a constitutively active PAK1 plasmid (pCMV6M-PAK1 T423E, Addgene plasmid # 12208 by Jonathan Chernoff), or 2 μg of a dominant-negative PAK1 plasmid (pCMV6M-PAK1 H83L H86L K299R ...
-
bioRxiv - Biochemistry 2021Quote: ... the cells were transfected with 1 μg of mutant library and 100 μg of Bxb1 expressing plasmid (pCAG–NLS–HA–Bxb1; Addgene #51271, a gift from Pawel Pelczar) in triplicate ...
-
bioRxiv - Neuroscience 2023Quote: Cre-dependent recombinant adeno-associated virus (rAAV) expressing GCaMP7f under the control of the Synapsin promoter (rAAV1-Syn-FLEX-jGCaMP7f-WPRE-Sv40, Addgene #104492, titer: 1 × 1013 vg/mL) was used to express GCaMP7f in interneurons.
-
bioRxiv - Neuroscience 2024Quote: ... We injected in that region 3x750nL of an adeno-associated virus (AAV) mix of AAV1.Syn.GCaMP (6m: Addgene 100841 or 7f: Addgene 104488; dilution 1:10 ∼ 1x1013 GC/mL) and AAV1.Syn.Flex.Chrimson.tdTomato (UNC Vector Core ...
-
bioRxiv - Cell Biology 2021Quote: ... Raji or SKW6.4) were infected with Cas9 expressing viruses that were produced in HEK293T cells transfected with the lentiCas9-Blast (#849, Addgene plasmid #52962), pMD2.G ...
-
bioRxiv - Neuroscience 2020Quote: 8 weeks old Mrap2fl/fl Mc4regfp females (n=4) were injected unilaterally with pAAV-Ef1a-mCherry-IRES-CRE (Addgene, catalog #55632-AAV8).
-
bioRxiv - Developmental Biology 2023Quote: Riboprobes for in situ hybridization were synthesized using the oligonucleotide primers listed in Supplementary Table 4 to clone the DNA fragment of interest into vector pJC53.2 (Addgene Plasmid ID: 26536), followed by riboprobe synthesis previously described 80.
-
bioRxiv - Cell Biology 2024Quote: ... The fragment encoding the Cerulean gene containing 3xNLS was amplified from the template pCerulean-PCNA-19-SV40NLS-4 (a gift from Michael Davidson; Addgene plasmid # 55437) using primer pair 6380 (5’- GGA GCC TCA GCC GCT TCA GCT GCT CCG GTC GCC ACC ATG GTG AG -3’ ...
-
bioRxiv - Genetics 2024Quote: pCDF5-U6-[4xgRNA-tRNA]-GFP was generated by cloning the 4 gRNAs targeting GFP from (Ma et al., 2016) in pCDF5 (Addgene #Plasmid #73914) (Port and Bullock ...