Labshake search
Citations for Addgene :
2701 - 2750 of 2799 citations for 3 1 3 Dioxan 2 yl 3' methoxypropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... the promoter was substituted by mDlx enhancer sequence from pAAV-mDlx-GFP-Fishell-1 (a gift from Gordon Fishell, Addgene plasmid # 83900) and cDNA encoding mCherry was further inserted into multicloning site 21 ...
-
bioRxiv - Neuroscience 2020Quote: ... two viruses were injected in the same animal: AAV1-Syn-NES-jRGECO1a-WPRE-SV40 (Addgene; 1 × 1013 GC/mL titer, 294.4 nL) in Cg1/M2 ...
-
bioRxiv - Plant Biology 2021Quote: ... was cloned together with pICH47802-p35S::ER:tdTOM::tNOS selection marker (position 1) in the final plant expression vector pAGM4673 (Addgene, catalog number: 48014). For simultaneous live imaging ...
-
bioRxiv - Neuroscience 2020Quote: The GECI AAV2/1-Syn-FLEX-mRuby2-CSG-P2A-GCaMP6m-WPRE-SV40 (titer: 2.9 x 1013 GC per ml, Addgene accession no. 102816) in combination with the Cre recombinase AAV2/1.CamKII0.4.Cre.SV40 (titer ...
-
bioRxiv - Neuroscience 2020Quote: ... each given at a total volume of 0.8 μl per hemisphere: 1) inhibitory Gi DREADD (AAV5-hSyn-hM4Di-mCherry; UNC Vector Core; n = 5; AAV8-hSyn-hM4Di-mCherry; Addgene; n = 5); excitatory Gq DREADD (AAV8-hSyn-hM3Gq-mCherry ...
-
bioRxiv - Genomics 2021Quote: ... 100 ng of a synthetic gblock encoding the the HS-CRM8-TTRmin module38 upstream of dsRed (Integrated DNA Technologies) and 1 μg of sgOpti (gift from Eric Lander and David Sabatini, Addgene plasmid #85681)39 ...
-
bioRxiv - Cell Biology 2021Quote: ... A control cell line was generated by infecting U2OS cells stably expressing a non-targeting sgRNA (above) with the lentivirus vector pLKO.1-blast-Scramble (Addgene, cat# 26701) expressing a non-targeting shRNA sequence and selected with 15µg/ml blasticidin for 7 days ...
-
bioRxiv - Cell Biology 2020Quote: WT and JMS hiPSCs were transduced with lentiviruses encloding for the non-specific control short-hairpin RNA (shControl; pLKO.1 puro (Addgene ID: 8453)) or the p53 targeting shRNA (shp53 pLKO.1 puro shRNA (Addgene ID ...
-
bioRxiv - Biochemistry 2022Quote: ... and CstF77 (Uniprot Q12996-1) were cloned into ligation-independent cloning (LIC) expression vectors 1B (gift from Scott Gradia, Addgene plasmid #29653), 1M (Addgene plasmid #29656) ...
-
bioRxiv - Neuroscience 2022Quote: ... GAD2-IRES-Cre mice were injected in the ZI with a 5:1 mix of AAV2/5-hSynapsin1-Flex-axon-GCaMP6s (Addgene, #112010-AAV5) and AAV2/9-FLEX-tdTomato (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... P0-1 pups received the viral construct AAV9-hSyn-hChR2(H134R)-EYFP (200 µl at titer ≥ 1×10¹³ vg/mL, #26973-AAV9, Addgene, MA, USA) into the OB and the retrograde virus AAVrg-CamKIIα-mCherry (80 µl at titer ≥ 7×10¹² vg/mL ...
-
High-performance GPCR optogenetics based on molecular properties of animal opsins, MosOpn3 and LamPPbioRxiv - Biochemistry 2022Quote: ... The vector backbone containing SL1 and GFP was obtained by digestion of the plasmid [pEM1 = flp-21::LoxPStopLoxP::npr-1 SL2 GFP] (Addgene plasmid # 24033)65 with NotI and KpnI ...
-
bioRxiv - Developmental Biology 2021Quote: The pU6-chiRNA:sgRNA plasmid was obtained by incorporating the sgRNA sequence (obtained by annealing phos-gRNA-F and phos-gRNA-R, Supplementary Table 1) into pU6- BbsI-chiRNA (Addgene plasmid # 45946) (22 ...
-
bioRxiv - Neuroscience 2021Quote: ... the adeno-associated virus AAV2/1-Syn-FLEX-mRuby2-CSG-P2A-GCaMP6m-WPRE-SV40 (titer: 2.9 x 1013 GC per ml, Addgene accession no. 102816) in combination with AAV2/1.CamKII0.4.Cre.SV40 (titer ...
-
bioRxiv - Cell Biology 2022Quote: ... we first generated a doxycycline-inducible Cas9-expressing THP-1 cell line (iCas9-expressing cells) by transducing THP-1 cells with lentiviruses carrying the Lenti-iCas9-neo plasmid (a gift from Qin Yan; Addgene plasmid #85400). Multiple guide RNAs targeting a gene were cloned into the Lenti-multi-Guide plasmid (a gift from Qin Yan ...
-
bioRxiv - Cancer Biology 2022Quote: ... Plasmid pENTR223-1 GCN2 (NM_001013703) was purchased from Transomic Technologies and pLX303 was a gift from David Root (Addgene plasmid # 25897, RRID:Addgene_25897). GCN2 coding sequence was subcloned into the lentiviral vector pLVX-IRES-Hygromycin (Clontech ...
-
bioRxiv - Cell Biology 2020Quote: ... pENTR-backbone was created by treating pENTR-Luc (w158-1, a gift from Drs. Eric Campeau and Paul Kaufman; Addgene plasmid #17473) with NcoI and XbaI (New England Biolabs ...
-
bioRxiv - Genetics 2020Quote: ... BLRR was then transferred to pLenti CMV Puro DEST (w118-1)(33) (a kind gift from Eric Campeau & Paul Kaufman; Addgene plasmid #17452) from pENTR-BLRR using Gateway LR Clonase II Enzyme mix (111791020 ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T cells were plated at 2.2 x 105 ml−1 and transfected the following day with shRNA-expressing plasmid (shSp7 or shLacZ plasmid) along with psPAX2 (Addgene, plasmid 12260) and pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... HEK293T cells were transiently transfected with 1 µg of a PCR cassette and 1 µg of pCAG- enAsCas12a(E174R/S542R/K548R)-NLS(nuc)-3xHA (gift from Keith Joung & Benjamin Kleinstiver, Addgene plasmid # 107941) using TransIT293 (Mirus ...
-
bioRxiv - Biochemistry 2021Quote: ... DNA encoding CGI-99 (Uniprot Q9Y224) was cloned into site 1 of the UC Berkeley MacroLab 5A vector (gift from Scott Gradia, Addgene plasmid #30121), while DNA sequence encoding FAM98B (Uniprot Q52LJ0 ...
-
bioRxiv - Immunology 2021Quote: ... and control Luciferase (shLuc, SHC007) were made by ligating annealed oligonucleotides into pLKO.1 (TRC cloning vector, a gift from David Root (Addgene plasmid #10878)) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and amplified ZBP1 cDNA using forward: GGGAATTCATGGCCCAGGCTCCTGCT and reverse: TAGCGGCCGCCTAAATCCCACCTCCCCA primers from pEGFPN.1 vector cloned into LeGO-iG2-IRES-EGFP vector (Addgene plasmid #27341) between EcoRI and NotI sites followed by 5x strep-tag II (TGGAGCCATCCGCAGTTTGAAAAA ...
-
bioRxiv - Cancer Biology 2021Quote: ... an annealed small interfering RNA cassette with a targeting sequence of GGACAACCCGUACAUCACC for RKTG and scramble sequences were inserted into the pLKO.1.-puro vector (Addgene, MA, USA) downstream of the U6 promoter Lentiviruses were obtained by co-transfecting a mixture of the indicated shRNA plasmid ...
-
bioRxiv - Microbiology 2020Quote: ... with the primers 5’-gtgtAGGCCTaaaaATGATTCGTGTTTATTTGATAATTTTAATGCA-3’ and 5’-gtgtGCTAGCCTAGAAAATGTTAATCGAAGTTTTGCGT-3’ and inserted into the NaeI-NheI sites of pCFJ150-mCherry(dpiRNA)::ANI-1(AHPH) (a gift from Heng-Chi Lee, Addgene plasmid #107939). Three expression constructs of PU6::rrf-3 sgRNAs were amplified by PCR from pDD162 using the primers 5’-GTATTGTGTTCGTTGAGTGACC-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... this cell line was co-transfected with a 9:1 ratio of pCENP-B-Cherry (a gift from Michael Lampson; Addgene plasmid #45219) and pPGKpuro resistance plasmid ...
-
bioRxiv - Neuroscience 2021Quote: For Ca2+ indicator expression at M1, recombinant AAV vectors (rAAVs, serotype 1) encoding jRGECO1a under the control of the synapsin promoter (Addgene #100854-AAV1) was stereotaxically delivered as follows ...
-
bioRxiv - Cancer Biology 2022Quote: ... full-length ROS1 cDNA was cloned using the SalI and XhoI sites in the multiple cloning site of pENTR4-No ccDB (696-1) vector (Addgene Plasmid #17424) via In-Fusion™ cloning using PCR amplification that included the adition of C-terminal Flag tag ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting exon 6 and exon 9 of human ATRX or mouse Atrx (Supplementary Table 1) were cloned into CRISPR-Cas9 lentiCRISPR v2 vector (gift from Feng Zhang, Addgene plasmid #52961). Lentivirus was produced in 293FT cells ...
-
bioRxiv - Bioengineering 2023Quote: ... The assembled fragment was sandwiched by two Smn1 intron 1 gRNA target sequence and subcloned into between ITRs of PX552 purchased from Addgene (Addgene 60958), and generated pAAV-SMN1-HITI ...
-
bioRxiv - Cell Biology 2023Quote: His-tagged Set9 protein expression was induced overnight at room temperature with 1 mM IPTG using BL21(DE3) Escherichia coli transformed with pET28 Set9 plasmid (Addgene plasmid #24082). Cells were pelleted at 7000 rpm for 20 minutes at 4°C using rotor JA-10 ...
-
bioRxiv - Biochemistry 2023Quote: ... and the 6xHis-SUMO tag was removed by enzymatic cleavage using human Sentrin-specific protease 1 (SENP1) catalytic domain (derived from pET28a-HsSENP1, that was a gift from Jorge Eduardo Azevedo (Addgene plasmid #71465) at 4°C overnight27,28 ...
-
bioRxiv - Cancer Biology 2023Quote: ... cloned into pLenti PGK Neo DEST (pLenti PGK Neo DEST (w531-1) a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 19067) by using the Gateway LR Clonase II Enzyme Mix (Invitrogen).
-
bioRxiv - Microbiology 2023Quote: The following plasmids were used in this study: pLenti CMV Blast DEST (706–1) (Ax203, a gift from Eric Campeau & Paul Kaufman, Addgene plasmid #17451); K8.1-OneStrep (OneStrep Tag ...
-
bioRxiv - Neuroscience 2023Quote: ... or left IC (0.9 mm caudal and 1 mm lateral from lambda suture) to inject 100-200 nL of pAAV-Syn-Chronos-GFP virus (Addgene #59170-AAV1). At the end of the surgery ...
-
bioRxiv - Plant Biology 2022Quote: ... we first added the FASTRED seed coat selection cassette (57, 58) and a MoClo (59) Level 1 acceptor site to the binary vector pICH86966 (Addgene plasmid #48075). pHAT7-HAT7-mCitrine and pGTL1-GTL1-mCitrine were assembled into this FASTRED destination vector using Level 1 BsaI golden gate assembly ...
-
bioRxiv - Molecular Biology 2024Quote: ... and a non-targeting control (F: GCACTACCAGAGCTAACTCAGATAGTACT) were designed using the BROAD Institute design tool and cloned into pLKO.1 vector (Addgene, Cat# 8453), followed by validating the successful insertions using Colony-PCR and Sanger sequencing ...
-
bioRxiv - Molecular Biology 2024Quote: The HTLV-1 CA (Gag amino acids 132-349) was cloned into the 6×His SUMO bacterial expression plasmid (pHYRSF53, Addgene, Watertown, MA), with mutants created by using the Gibson assembly procedure ...
-
bioRxiv - Neuroscience 2024Quote: ... packaged at UPenn Vector Core 2.5 × 1014 GC ml−1] and KORD [AAV8-HSyn-DIO-HA-KORD-IRES-mCitrine (Addgene plasmid no. 65417), packaged at UPenn Vector Core ...
-
bioRxiv - Immunology 2024Quote: ... Production of lentiviral particles was performed by transient co-transfection (polyethylenimine:DNA at 3.5:1 ratio) of HEK 293T cells with the second-generation packaging system plasmid psPAX2 and pMD2.G (Addgene, 12260 and 12259). Viral supernatants were harvested at 48h post-transfection ...
-
bioRxiv - Neuroscience 2023Quote: Calcium indicator expression in vLGN/IGL neurons was achieved with AAV-hSynapsin1- FLEx-axon-GCaMP6s (1 × 1012 genome copies per ml, Addgene, 112010-AAV5) for retinal expression AAV2.7M8-syn-GCaMP8m viral vectors (1 × 1013 genome copies per ml) ...
-
bioRxiv - Cell Biology 2023Quote: ... two shRNAs targeting EZH2 (shEZH2-a: CCGGCCCAACATAGATGGACCAAATCTCGAGATTTGGTCCATCTATGTTGGGTTTTT G and shEZH2-b: CCGG CGGAAATCTTAAACCAAGAATCTCGAGATTCTTGGTTTAA GA TTTCCG TTTTTG) were designed and cloned into pLKO.1 vector (Addgene plasmid #10879) according to method by Moffat ...
-
bioRxiv - Cancer Biology 2023Quote: ... For each microgram crude eccDNA we spiked in 1 ng pUC1932 (was a gift from Joachim Messing, Addgene plasmid # 50005; RRID: Addgene_50005) and 1 ng egfr fragment to generate crude circular DNA mixture.
-
bioRxiv - Biochemistry 2024Quote: We also constructed pFGH1-UTG-mTagBFP2 as empty vectors by inserting PCR-amplified mTagBFP2 from pLKO.1 - TRC (a gift from Timothy Ryan; Addgene plasmid #191566) into digested backbone from pFGH1-UTG ...
-
bioRxiv - Cancer Biology 2023Quote: ... and SNAI1 knockdown cells were generated by cloning respective shRNA sequences into the 3rd generation lentiviral plasmid pLKO.1 TRC cloning vector (Addgene, cat# 10878) between unique AgeI and EcoRI sites downstream of the U6 promoter ...
-
bioRxiv - Molecular Biology 2022Quote: ... pcDNA3.1-HA-UBA6, containing the coding sequence for UBA6 (aa1-1052, Uniprot: A0AVT1) was a gift from Marcus Groettrup (Addgene plasmid #136995). UBA6 was subcloned into pDARMO with an N-terminal FLAG-tag ...
-
bioRxiv - Microbiology 2022Quote: Individual guide RNA (gRNA) sequences (Supplemental Table 1) were cloned into BsmBI-digested lentiCRISPRv2 (Addgene #52961, a gift from Feng Zhang [10]) and resulting lentiviral stocks prepared as previously described [11] ...
-
bioRxiv - Biochemistry 2022Quote: ... by Gateway LR reactions (Resulting pAG416GPD-PpMAX1c). Then these constructs were co-transformed with ATR1 (NADPH-CYP reductase 1 from A. thaliana) expression vector (Addgene, Catalog # 178288) into the Saccharomyces cerevisiae wild-type strain CEN.PK2-1D using the Frozen-EZ yeast transformation II kit (Zymo Research ...
-
bioRxiv - Neuroscience 2023Quote: ... 2.3 x 1013 vg/mL) or 200 nL/side AAV5-CMV-HI-eGFP-Cre-WPRE-SV4 (Addgene; ≥ 1 x 1013 vg/mL) was injected at a rate of 100 nL/min into the insula of Pdynlox/lox and Oprk1lox/lox mice ...
-
bioRxiv - Developmental Biology 2023Quote: ... The destination vector used in this study was pLenti CMV Neo DEST (705-1) (gift from Eric Campeau & Paul Kaufman; Addgene plasmid #17392). Once validated ...