Labshake search
Citations for Addgene :
2451 - 2500 of 2799 citations for 3 1 3 Dioxan 2 yl 3' methoxypropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... and MHH-ES-1 were transduced with lentiviral Tet-pLKO-puro all-in-one vector system (plasmid #21915, Addgene) containing a puromycin-resistance cassette ...
-
bioRxiv - Physiology 2024Quote: - pLenti CMV Puro DEST (w118-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17452; http://n2t.net/addgene:17452; RRID: Addgene_17452)
-
bioRxiv - Physiology 2024Quote: - pENTR1A no ccDB (w48-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17398; http://n2t.net/addgene:17398; RRID: Addgene_17398)
-
bioRxiv - Neuroscience 2024Quote: The following virus vectors were used for experiments: adeno-associated virus (AAV)1-Syn-Flex-ChrimsonR-Tdtomato (Addgene #62723), AAV2retro-cFos-tTA-pA (Addgene #66794) ...
-
bioRxiv - Neuroscience 2024Quote: ... each mouse was transduced with a cocktail of CRE recombinase-dependent AAV vectors to express Brainbow 3.0 (AAV-EF1a-BbTagBY and AAV-EF1a-BbChT; titers ≥ 1×10¹³ vg/mL; Addgene) 60 under isoflurane anesthesia ...
-
bioRxiv - Neuroscience 2024Quote: ... At P1-P2 pups were anaesthetized with Iso-fluorane and intra-cortically injected with 1 ul of a viral solution containing (AAV-EF1A-Gephyrin.FingR-GFP-CCR5TC – Addgene#125692 and AAV-CAG-tdTomato - Addgene# 59462 ...
-
bioRxiv - Bioengineering 2024Quote: ... D-REPRESS 1 to 6 plasmids were cloned following the same manner with dRfxCas13d amplification from pXR002 (Addgene #109050)24 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The shRNA sequences for GJB3 knockdown were generated via the GPP Web Portal (https://portals.broadinstitute.org/gpp/public/) and subsequently cloned into the lentiviral vector pLKO.1 puro (Addgene, 8453). To study autophagy in GJB3-silenced cells ...
-
bioRxiv - Biochemistry 2024Quote: ... The extracellular ADAM17 pro- and metalloprotease domains (residues 1– 477) were cloned into the pLib vector (Addgene: Plasmid #80610), which includes a 6x HisTag at the carboxyl terminus 76 ...
-
bioRxiv - Biochemistry 2024Quote: ... The pOPINB-M1-di-Ub(G76V)-HOIL-1 fusion plasmid for bacterial expression is available from Addgene (Plasmid # 229539). Saccharides were purchased from Biosynth Carbosynth (UK) ...
-
bioRxiv - Cell Biology 2024Quote: ... we cloned human OPTN cDNA in a pETDuet-1 vector with an N-terminal 6xHis tag followed by a TEV cleavage site (RRID:Addgene_190191). After the transformation of the pETDuet-1 vector encoding 6xHis-TEV-mCherry-OPTN in E ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transfected with 1 ug each of pSpCas9n(BB)-2A-Puro (PX462) V2.0 and pSpCas9n(BB)-2A-GFP (PX461) (Addgene.org) containing guide RNA sequences for human PANX1 in a 6-well plate ...
-
bioRxiv - Cell Biology 2024Quote: ... The KIF5A-mVenus-iLID was cloned by first substituting the SspB in KIF1A(1-365)-Venus-SspB (Addgene #174635) (Nijenhuis et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... the cytosol-exposed domain of NIX (1-182aa) was fused to a C-terminal GST-tag through cloning into a pET-DUET1 vector (RRID:Addgene_223733). Point mutants were introduced by in vitro mutagenesis to generate NIX E72A/L75A/D77A/E81A (4A ...
-
bioRxiv - Cell Biology 2024Quote: ... the cytosol-exposed domain of BCL2L13 (1-465aa) was fused to a C-terminal GST-tag through cloning into a pET-DUET1 vector (RRID:Addgene_223744). Point mutants were introduced by in vitro mutagenesis to generate BCL2L13 W276A/I279A (ΔLIR1 ...
-
bioRxiv - Cell Biology 2024Quote: ... the cytosol-exposed domain of FUNDC1 (1-50aa) was fused to a C-terminal GST-tag through cloning into a pET-DUET1 vector (RRID:Addgene_223734). Point mutants were introduced by in vitro mutagenesis to generate FUNDC1 Y18A/L21A (ΔLIR ...
-
bioRxiv - Cell Biology 2024Quote: ... TRIM24 shRNAs (C1 and C2) were cloned into the pLKO.1 TRC vector according to the protocols from Addgene.
-
bioRxiv - Cell Biology 2024Quote: shRNA sequences were designed using BLOCK-iT™ RNAi Designer and cloned into the pLKO.1 vector (Addgene #8453). The vector was digested with AgeI (Abclonal ...
-
bioRxiv - Developmental Biology 2024Quote: shRNA sequences were designed using BLOCK-iT™ RNAi Designer and cloned into the pLKO.1 vector (Addgene #8453). The vector was digested with AgeI (Abclonal ...
-
bioRxiv - Genetics 2024Quote: ... Histones H3.1 and H3.1K27M (aa 1-136) were inserted into the Gateway destination vector pGWB-nLUC (Addgene Plasmid #174050). Agrobacterium tumefaciens GV3101 strains harboring these constructs were introduced into the leaves of 4-week-old Nicotiana benthamiana plants ...
-
bioRxiv - Cell Biology 2024Quote: ... were recombined into intron 1 of the mouse Rosa26 locus using the targeting vector STOP-eGFP-ROSA26TV (Addgene #11739)56 ...
-
bioRxiv - Cancer Biology 2021Quote: The lentiviral constructs encoding mKO2-SLBP(18-126) and Clover-Geminin(1-110) were a gift from Michael Lin (Addgene plasmid # 83915 ...
-
bioRxiv - Cell Biology 2020Quote: ... and further subcloned into a CMV driven vector (pLenti CMV V5-LUC Blast (w567-1) was a gift from Eric Campeau (Addgene plasmid #21474 ...
-
bioRxiv - Cell Biology 2020Quote: Pairs of CRISPR guide RNA oligos (mouse Chmp5 single guide RNAs [sgRNAs] targeting GGCTCCGCCACCTAGCTTGA and GTTTCGCTTTTCCGAAGAAT on exon 1 respectively) were annealed and cloned into the BsmBI sites of lentiCRISPR V2-puro vector (plasmid 52961, Addgene). CRISPR lentiviral plasmids and lentiviral packaging plasmids (pMDLg/pRRE ...
-
bioRxiv - Immunology 2021Quote: ... a human RNH1-full coding sequence (ORIGEN RC 200082) insert was cloned into the entry vector pENTR4-GFP-C1 (W392-1, Addgene) and then recombined into the destination vector pLenti CMV Blast DEST (706-1 ...
-
bioRxiv - Immunology 2021Quote: RNH1-KO THP1 cells were infected with lentiviruses expressing RNH1 (pLenti CMV Blast GFP-RNH1) or the empty vector pLentiCMV-GFP-Blast (659-1, Addgene) as previously described (Papin et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... to co-transfect pBABE-puro or pBABE-puro.SLX4IP.3xFLAG with pCMV-VSV-G (at a ratio of 6:1, Addgene#8454) into GP2-293 cells (Clontech) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... to specifically target TP53 translation stop site and it was cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem (1/110) (Addgene #71707) according to the protocol of Ran et al.51 ...
-
bioRxiv - Neuroscience 2020Quote: ... Whole-cell patch-clamp recordings were also performed for functional evaluation of Cl− microdomains (Figure 1) on organotypic slices of DLX-Cre mice which were transfected on the day of slicing with tdTomato virus (Addgene-AAV9-CAG-FLEX-tdTomato ...
-
bioRxiv - Biochemistry 2020Quote: ... H-HCF-1) and full length human THAP11 cDNA with carboxy-terminal FLAG tag (Plasmid #28020; F-THAP11) were obtained from Addgene. Vectors containing full length human THAP1 cDNA with carboxy-terminal 1X FLAG tag (THAP1-F ...
-
bioRxiv - Biophysics 2020Quote: ... as per the manufacturer’s instructions into pLenti CMV Hygro DEST (W117-1, a gift from Dr. Eric Campeau & Dr. Paul Kaufman, Addgene #17454) to create the final vector which was sequence verified by Sanger sequencing (Australian Genome Research Facility) ...
-
bioRxiv - Cancer Biology 2020Quote: ... we designed single guide RNAs specifically targeting exon 1 of the mouse Bmal1 gene and subcloned it into the PX459 vector (Addgene) to obtain the PX459-Bmal1 plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... NANOG and PRDM14 (see Table 1) were cloned into pLentiCRISPR V2 vectors with puro (SOX2, NANOG) or hygromycin B (PRDM14) resistance (Addgene plasmids #52961 and #98291 respectively ...
-
bioRxiv - Cell Biology 2021Quote: ... and pLKO.1 puro-based plasmid harboring the designed shRNA (pCMV-VSV-G and pLKO.1 puro were a gift from Bob Weinberg, Addgene plasmid #8454 ...
-
bioRxiv - Neuroscience 2020Quote: PV-Cre and SST-Cre slices were transfected in three different configurations: 1) 2.2 μL of ChETA (pAAV9-Ef1a-DIO-ChETA-EYFP Addgene#: 26968) and 1 μL of LSL-tdTomato (Addgene# ...
-
bioRxiv - Molecular Biology 2020Quote: A pET28a vector with sub-cloned cDNA of Hsp53-(1-73) (72R) and the N-terminal His-tag was procured from Addgene, (plasmid #62082) ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of pEA216-1 was then co-transfected with 5 μg of the pCMVΔR8.2 helper plasmid (Addgene Plasmid #122263) and 1 μg of pHEF-VSV-G into 70% confluent monolayers of 293T cells in a 10 cm dish using polyethylenimine (Polysciences Inc ...
-
bioRxiv - Neuroscience 2020Quote: ... to label hyaluronic acid-based ECM we designed AAV expression vector carrying link protein hyaluronan and proteoglycan link protein 1 (HAPLN1, Gene ID: 12950) fused with mScarlet subcloned from the plasmid pCytERM_mScarlet_N1 (Addgene plasmid # 85066). Clones were verified by sequencing analysis and used for the production of adeno-associated particles as described previously (Mitlöhner et al ...
-
bioRxiv - Bioengineering 2020Quote: ... 400,000 HEK cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 (Addgene #12260), 3 μg pCMV-VSV.G (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: Huwe1 stable knockdown: The same targeting sequences as for siRNA studies were cloned to pLKO.1 puro plasmid (Addgene 8453). As control ...
-
bioRxiv - Cancer Biology 2021Quote: ... Luciferase was introduced into pediatric brain tumor cell lines using lentiviral plasmids: pLenti CMV Puro LUC (w168-1) was a gift from Eric Campeau & Paul Kaufman(45) (Addgene plasmid # 17477 ...
-
bioRxiv - Cell Biology 2022Quote: ... RPE-1 TUB-mRFP cells were generated in our lab by transduction with lentiviral vectors containing tubulin m-RFP (Addgene). HEK293T cells at a 50-70% confluence were co-transfected with lentiviral packaging vectors (16.6 μg of Pax2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were transfected with a 6:1 ratio of a firefly luciferase reporter plasmid driven by a pGL3-RARE-responsive promoter (Addgene) and a Renilla luciferase reporter plasmid driven by a constitutive CMV promoter (Promega) ...
-
bioRxiv - Biochemistry 2022Quote: ... full-length FUS with an N-terminal histidine tag and maltose-binding protein fusion (pTHMT FUS 1-526, AddGene #98651), and FUS RGG3 with N-terminal histidine tag and MBP fusion (pTHMT FUS RGG3 (453-507) ...
-
bioRxiv - Cell Biology 2022Quote: ... organoid fragments were washed and resuspended in Opti-MEM supplemented with Y-27632 (10 µM) and 10µg of pSPgRNA plasmid together with the frame selector plasmid pCAS9-mCherry-Frame +1 (Addgene #66940) and the mNEON targeting plasmid (a kind gift from V ...
-
bioRxiv - Microbiology 2022Quote: Retrovirus particles for transduction and stable cell generation were produced in HNE-1 cells following JetPrime transfection of expression plasmids (pBabe neo, pBabe-HA-LMP1 neo) and packaging plasmids pMD2.G (Addgene; number 12259 ...
-
bioRxiv - Cell Biology 2022Quote: A His-tagged mouse Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was obtained from Addgene as described above (Plasmid #89950) ...
-
bioRxiv - Neuroscience 2021Quote: Other viruses used in the paper: AAV2/1-hSyn-hChR2(H134R)-EYFP was a gift from Karl Deisseroth (Addgene #26973); AAV2/1-hSyn-hM3D(Gq)-mCherry was a gift from Bryan Roth (Addgene #50474) ...
-
bioRxiv - Neuroscience 2020Quote: Full-length Susd4 mouse gene was cloned into the mammalian expression vector pEGFP-N1 (Addgene, Massachusetts, USA, Cat#6085-1) to express a SUSD4-GFP fusion construct under the control of the CMV promoter (pSUSD4-GFP) ...
-
bioRxiv - Cell Biology 2021Quote: ... Exogenous cells - MDCK cells were mosaically transfected using a CMV GFP vector (pLenti CMV GFP Blast (659-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17445 ...