Labshake search
Citations for Addgene :
2351 - 2400 of 2799 citations for 3 1 3 Dioxan 2 yl 3' methoxypropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... MEFs cells were infected with a pLKO.1-Puro plasmid encoding a scrambled shRNA sequence (Addgene plasmid #1864). A list of the shRNA sequences is provided in Supplementary Table 2.
-
bioRxiv - Plant Biology 2023Quote: ... The resulting amplicons were assembled in Level 1 acceptors with an AtU626 promoter (pICSL90002, AtU6-26 Addgene#68261). The final construct was assembled by combining the two Level 1 sgRNA cassettes with cassettes for resistance to kanamycin pICSL11024 (Addgene#51144 ...
-
bioRxiv - Immunology 2022Quote: shRNAs were designed to target human Galectin-9 mRNA and cloned into the pLKO.1 vector (Addgene #10878). The sense shRNA sequences are CCTGGTGCAGAGCTCAGATTT (shGal-9 #1 ...
-
bioRxiv - Genomics 2022Quote: ... The open reading frames of H3 and H4 were cloned in the Dox-inducible expression vector KA0717 (KA0717_pPB-hCMV*1-cHA-IRESVenus was a gift from Hans Schöler, Addgene plasmid #124168 ...
-
bioRxiv - Developmental Biology 2023Quote: ... nls::Cas9::nls (subcloned from Eef1a-1955/- 1>nls::Cas9::nls a gift from Lionel Christiaen, Addgene plasmid # 59987 ;http://n2t.net/addgene:59987 ; RRID:Addgene_59987)52 ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... coding for the large T oncogene SV40 (V40 1: pBSSVD2005 was a gift from David Ron; Addgene plasmid #21826; http://n2t.net/addgene:21826; RRID:Addgene_21826), using LipofectamineTM LTX (Invitrogen #L3000-008 ...
-
bioRxiv - Cancer Biology 2023Quote: ... (MSCV-IRES-Thy1.1 DEST was provided to Addgene by Dr. Anjana Rao, Addgene plasmid# 17442 ; http://n2t.net/addgene:17442 ; RRID:Addgene_17442) using TaKaRa In-Fusion HD Cloning Plus kits (Cat# 638917 ...
-
bioRxiv - Neuroscience 2023Quote: ... The annealed oligos were then ligated into U6 promotor-based cassettes: ipo13b sgRNA1 into pU6a:sgRNA#1 (Addgene #64245), ipo13b sgRNA2 into pU6a:sgRNA#2 (Addgene #64246) ...
-
bioRxiv - Cell Biology 2024Quote: ... pCSII-EF-miRFP670v1-hGem(1/110) was a gift from Vladislav Verkhusha (Addgene plasmid # 80006; http://n2t.net/addgene:80006; RRID:Addgene_80006). Supernatants containing lentiviral pseudoparticles were harvested 24 and 48 h post-transfection ...
-
bioRxiv - Molecular Biology 2024Quote: ... p6346 MSCV-CMV-Flag-HA-Brd4-1-444 were from Peter Howley (Addgene 31352, 32886, 31353, 31354, 31355). Constructs for pcDNA5-Flag-BRD4 WT ...
-
bioRxiv - Neuroscience 2024Quote: ... the left eye was injected with 800 nL – 1 μL of AAV2/7m8-CAG-DIO-ChRger2-YFP (Addgene Plasmid #127329 packaged by BCH viral core) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pLKO.1 shRNA plasmid targeting human TSC2 was a gift from Do-Hyung Kim (Cat#15478, Addgene). Lentiviral pLKO shRNA plasmids were transiently co-transfected individually along with plasmids encoding ΔVPR and VSV-G into HEK293T cells using TurboFect™ (Cat#R0531 ...
-
bioRxiv - Neuroscience 2024Quote: ... An intersectional approach was used for selective activation of mPFC to BLA projection using chemogenetics: 1) retrograde AAV encoding FlpO (0.3 μL, titer ≥ 7 x 1012 GC/ml, Addgene# 55637; RRID:Addgene_55637) were bilaterally injected into BLA (A-P ...
-
bioRxiv - Bioengineering 2024Quote: The Talin 1 rod domain R1-R2 (mouse talin1 482-786) was flanked between SNAP-tag (Addgene #101135) and HaloTag (Promega G8031) ...
-
bioRxiv - Neuroscience 2024Quote: ... The generated myo-3p::circ-crh-1 construct along with the unc-122p::RFP co-injection marker (AddGene) were injected into VDL1300 crh-1(syb385) ...
-
bioRxiv - Immunology 2024Quote: E2F-1 wt-pGex2TK was a gift from William Kaelin (Addgene plasmid # 21668 ; http://n2t.net/addgene:21668 ; RRID:Addgene_21668). The construct was cloned into N- terminal maltose-binding protein (MBP ...
-
bioRxiv - Cell Biology 2024Quote: ... and safe-targets (sgSAFE #5784) (see Table 1) were selected from the Bassik Human CRISPR Knockout Library (Addgene, 101926 ...
-
bioRxiv - Neuroscience 2024Quote: ... or the control reporter mCherry (AAV5-hsyn-DIO-mcherry, Addgene #50459 titre: 1:4 – 7×10¹² GC/mL).
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral cloning vector pLKO.1-TRC and pcDNA3.1-C-Flag plasmids were purchased from Addgene (Watertown, MA, USA). The double-stranded oligonucleotide shRNAs targeting LINC00094 were cloned into the Age I/EcoR I sites of the pLKO.1-TRC lentiviral vector ...
-
bioRxiv - Synthetic Biology 2024Quote: The pGDP1 NDM-1 and pGDP2 MCR-143 were gifts from Gerard Wright (Addgene plasmids #112883 and #118404). They were used as constitutive expression vectors for a codon-optimized blaNDM-1 (by the Pbla promoter ...
-
bioRxiv - Plant Biology 2024Quote: ... the SacB expression cassette was first cloned into the p641-BpiI level 1 vector using pT18mobsacB (Addgene #72648) as PCR template ...
-
bioRxiv - Cell Biology 2024Quote: ... full-length ARHGAP12 cDNA and ARHGAP12 fragments were PCR amplified and inserted into pEGFP-C1 (Addgene #6084-1) using appropriate restriction sites ...
-
bioRxiv - Bioengineering 2024Quote: ... was amplified using primers 5 and 6 listed in Supplementary Table 1 from pEPkan-S (Addgene plasmid #41017; http://n2t.net/addgene:41017; RRID:Addgene_41017) 13 and inserted into the XhoI site of pBS-Puro2ABFP-WPRE using GeneArt Gibson Assembly EX Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and pLenti CMV Puro DEST (w118-1) were gifts from Eric Campeau & Paul Kaufman (Addgene plasmid #17398, http://n2t.net/addgene:17398, RRID:Addgene_17398 ...
-
bioRxiv - Cell Biology 2024Quote: ... The plasmid encoding HIV-1 Gag-mCherry was a gift from Gregory Melikyan (Addgene plasmid # 85390 ; http://n2t.net/addgene:85390 ; RRID:Addgene_85390) (74) ...
-
bioRxiv - Cell Biology 2020Quote: ... and further subcloned into a CMV driven vector (pLenti CMV V5-LUC Blast (w567-1) was a gift from Eric Campeau (Addgene plasmid #21474 ; http://n2t.net/addgene:21474 ; RRID:Addgene_21474 49)) ...
-
bioRxiv - Cell Biology 2020Quote: ... and WD repeat domain phosphoinositide-interacting protein 1 (WIPI1) cDNA was a gift from Noboru Mizushima (Addgene plasmid # 38272) (Itakura & Mizushima ...
-
bioRxiv - Molecular Biology 2020Quote: ... and Gibson-assembled with the HaloTag gene amplified with primers HaloTag_F and HaloTag_R (Table 1) and pFA6a-HaloTag-KanMX6 (Addgene #87029) as a template ...
-
bioRxiv - Cell Biology 2022Quote: Human FL-RING1A (1–406aa) and CSD HP1β(80–185aa) were subcloned into bacterial expression 1GFP vector (Addgene #29663) and 1B vector (Addgene #29653) ...
-
Mapping of the autophagosomal degradome identifies IL-7Rα as key cargo in proliferating CD4+ T-cellsbioRxiv - Immunology 2021Quote: P-Lenti CMV/TO SV40 small + Large T (w612-1) was a gift from Eric Campeau (Addgene plasmid # 22298). For packaging the virus ...
-
bioRxiv - Genomics 2020Quote: ... shINTS2 and shINTS5 were designed with the Broad Institute algorithm (https://portals.broadinstitute.org/gpp/public/) and subsequently cloned into pLKO.1 (Addgene #10879). Sequences of all shRNAs are listed in the Key Resources Table ...
-
bioRxiv - Cancer Biology 2021Quote: Mouse Trp53 transcript variant 1 (NM_011640.3) was cloned into the retroviral vector pMSCV-IRES-GFP II (Addgene plasmid #52107). Trp53 point mutations were introduced using site-directed mutagenesis with the Q5 Site-Directed Mutagenesis Kit (New England Biolabs E0552S) ...
-
bioRxiv - Biochemistry 2021Quote: Gene encoding GFP was cloned under 1 kb promoter of GDH2 and PEPCK into pIB3 vector (Addgene plasmid #25452) and expressed in P ...
-
bioRxiv - Cell Biology 2021Quote: ... used for creating tetracycline-inducible cell lines were gifts from Eric Campeau (w762-1: Addgene plasmid #26434; http://n2t.net/addgene:26434; RRID: Addgene_26434 ...
-
bioRxiv - Cell Biology 2021Quote: ... and pLKO.1 puro-based plasmid harboring the designed shRNA (pCMV-VSV-G and pLKO.1 puro were a gift from Bob Weinberg, Addgene plasmid #8454; http://n2t.net/addgene:8454; RRID: Addgene_8454 ...
-
bioRxiv - Cancer Biology 2020Quote: ... pLenti CMV Puro DEST (w118-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid# 17452; RRID: Addgene_17452). The open reading frame for MCL1 was obtained as a gift from Dr ...
-
bioRxiv - Cancer Biology 2020Quote: ... pLenti CMV Puro DEST (w118-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid# 17452; RRID: Addgene_17452). The open reading frame for MCL1 was obtained as a gift from Dr ...
-
bioRxiv - Cancer Biology 2020Quote: ... and pLenti CMVTRE3G eGFP Neo (w821-1) were gifts from Eric Campeau (Addgene plasmids #26429 and #27569; RRIDs: Addgene_26429 and Addgene_27569). BCL2L1 (Bcl-xL ...
-
bioRxiv - Microbiology 2020Quote: ... DNA encoding residues 1-177 of both human RAC1 and CDC42 were cloned into an unmodified pET-28a (Addgene) vector that encodes an N-terminal TEV-cleavable 6xHis-tag using the NdeI/XhoI sites ...
-
bioRxiv - Molecular Biology 2020Quote: ... The two configurations that enabled efficient packaging of full-length vector genomes (designs 1 and 4) are available on Addgene (pEJS1099: Dual-sgRNA:Design 4, Addgene #159537 ...
-
bioRxiv - Cell Biology 2021Quote: ... EGFP and 1 kb homology arms flanking the insertion site were cloned into pHD-DsRed-attP (Addgene plasmid #51019) using Infusion technology (Takara/Clontech) ...
-
bioRxiv - Cell Biology 2021Quote: ... pAAV-mDlx-GFP-Fishell-1 was kindly provided by Gordon Fishell (Addgene plasmid #83900; http://n2t.net/addgene:83900; RRID: Addgene_83900). The AAV plasmid vector including the mouse alpha-CaMKII promoter was kindly provided by Akihiro Yamanaka (Nagoya University) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Caprin-1 were expressed using a pET-derived expression vector (Addgene, pET His6 MBP Asn10 TEV LIC, 1C) in E.coli Rosetta as N-terminal fusions to an N-terminally His6-tagged E.coli maltose-binding protein (MBP) ...
-
bioRxiv - Biochemistry 2021Quote: ... targets were identified for testing in exon 1 Ensembl.org exon id=ENSMUSE00000375205 with the algorithm described by Hsu and colleagues52 and cloned into plasmid pX330 (Addgene.org plasmid #42230 ...
-
bioRxiv - Immunology 2020Quote: ... The sgRNA sequence against HPT (Table 1) was cloned into the pSS013-Cas9 vector (pU6 plasmid, Addgene plasmid # 52694) using the BsaI specific sites ...
-
bioRxiv - Neuroscience 2020Quote: ... we infected adult Brn3cCre mouse retinas with 1 ml Cre dependent AAV Virus (AAV2-CAG-FLEX-EGFP-WPRE, Addgene catalog # ...
-
bioRxiv - Cancer Biology 2021Quote: ... These pLKO.1 constructions were transfected in the 293T packaging cell line along with pMD2.G and pCMV-dR8.91 vectors (Addgene), following a typical Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... and a separate master mix was prepared comprising 1 mL Opti-MEM 8 µg PSPAX (12260, Addgene, Watertown, MA), 2 µg PMD2G plasmids (12259 ...
-
bioRxiv - Biochemistry 2020Quote: ... To generate mec-4p∷hrp-1 mScarlet plasmids, mScarlet (Bindels et al., 2017) was amplified from pmScarlet_C1 (Addgene 85042) and assembled into hrp-1HsLCWT using NEBuilder HiFi DNA Assembly kit and introducing the D290V mutation by Quickchange ...
-
bioRxiv - Cell Biology 2022Quote: ... then ligated into the pENTR1A no ccDB (w48-1) vector (a gift from Eric Campeau and Paul Kaufman, Addgene plasmid # 17398 ...