Labshake search
Citations for Addgene :
201 - 250 of 2254 citations for Mouse Cell Surface Hyaluronidase CEMIP2 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... The mouse Brie CRISPR knockout pooled library was a gift from David Root and John Doench (Addgene #73633) (Doench et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... The plasmid kit used for the generation of TALENs was a gift of Daniel Voytas and Adam Bogdanove (Addgene kit #1000000016). Plasmid encoding assembled TALENs was linearized with SacI ...
-
bioRxiv - Plant Biology 2020Quote: ... GFP tagged OsHIPP19 and OsHIPP20 were generated by Golden Gate methods (Engler et al. 2008) using MoClo Plant Parts Kit and MoClo Plant Tool Kit (Addgene, UK). OsHIPP19 and OsHIPP20 were cloned into pICH47732 with a GFP tag at the N-terminus ...
-
bioRxiv - Biochemistry 2024Quote: Plasmids encoding GPCRs were obtained from various sources (as indicated Key Resources Table) or subcloned into pcDNA3.1 from the PRESTO-Tango GPCR kit (Addgene Kit #1000000068) as described next ...
-
bioRxiv - Plant Biology 2024Quote: ... Plasmid construction was performed by modular cloning using the MoClo Tool Kit and the MoClo Plant Parts Kit (Addgene, 28–30). A detailed MoClo protocol and the list of vectors used can be found in 18.
-
bioRxiv - Neuroscience 2022Quote: ... we cloned the dgn-1 promoter and AcNPV p10 3’UTR into the vector pPD49.26 (from the Andrew Fire plasmid kit, Addgene Kit #1000000001) to generate plasmid pNTC2 ...
-
bioRxiv - Cell Biology 2023Quote: ... were constructed in according to Golden Gate TALEN assembly protocol and using the Golden Gate TALEN and TAL Effector Kit 2.0 (Addgene, Kit #1000000024). CIscript-GoldyTALEN was a gift from Daniel Carlson & Stephen Ekker (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... The 7x sgRNAs targeting Gramd1a/b were selected using the tool CRISPOR v5.2 [62] and assembled as previously described using the multiplex CRISPR/Cas9 assembly kit [63] (Addgene kit # 1000000055). sgRNAs sequences and oligos used for cloning are provided in Supplemental Table 5 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Knockout cells generated in 293A and HeLa cells were created with pLentiCRISPRv2 (Addgene, #52961) containing indicated gRNAs (Figure 7-figure supplement 1) ...
-
bioRxiv - Neuroscience 2022Quote: ... HEK293T cells (#240073, Addgene, USA) were used for viral production ...
-
bioRxiv - Genomics 2023Quote: ... transfection kit and packaging plasmids pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260) ...
-
bioRxiv - Plant Biology 2024Quote: ... and terminators) from the GB2.0 kit purchased from Addgene (https://www.addgene.org/kits/orzaez-goldenbraid2/) ...
-
bioRxiv - Cell Biology 2020Quote: ... The mouse N-terminal Flag-tagged TRAF6 (Flag-TRAF6) mammalian expression plasmid was purchased from Addgene (#21624, GenBank: BAA12705.1). N-terminally GST-tagged TRAF6 (GST-TRAF6 ...
-
bioRxiv - Cancer Biology 2021Quote: Mouse Trp53 transcript variant 1 (NM_011640.3) was cloned into the retroviral vector pMSCV-IRES-GFP II (Addgene plasmid #52107). Trp53 point mutations were introduced using site-directed mutagenesis with the Q5 Site-Directed Mutagenesis Kit (New England Biolabs E0552S) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The mouse Spdef cDNA and human SPDEF cDNA were synthetized from IDT and cloned into LentiV P2A Blast (Addgene_111887) using Gibson assembly (NEB).
-
bioRxiv - Neuroscience 2020Quote: ... we infected adult Brn3cCre mouse retinas with 1 ml Cre dependent AAV Virus (AAV2-CAG-FLEX-EGFP-WPRE, Addgene catalog # ...
-
bioRxiv - Immunology 2020Quote: The targeting constructs used for introducing the in-frame mAID sequences into mouse endogenous CTCF locus (pEN84, Addgene #86230) and for introducing the OsTir1-V5 expression cassette into endogenous Rosa26 locus (pEN114 ...
-
bioRxiv - Developmental Biology 2020Quote: The plasmid encoding for the mouse Dbx2 RNA probe was a gift from Thomas Jessell (Addgene plasmid 16288; 33). Instead ...
-
bioRxiv - Cell Biology 2020Quote: Mouse CRISPR GeCKO v2 Knockout Pooled Library (Shalem et al., 2014, Sanjana et al., 2014) was purchased from Addgene. The library was amplified according to the developer’s protocol (Shalem et al. ...
-
bioRxiv - Immunology 2021Quote: 1C metabolism gRNA library was curated by referencing the Mouse CRISPR Knockout Pooled Library (Brie) (Addgene, Pooled Library #73632) (Doench et al. ...
-
bioRxiv - Immunology 2020Quote: ... A plasmid library of sgRNAs targeting all protein coding genes in the mouse genome (Brie Knockout library, Addgene 73633) was packaged into lentivirus using HEK293T cells ...
-
bioRxiv - Immunology 2020Quote: The mouse Brie CRISPR knockout pooled library (lentiCRISPRv2 backbone; a gift from David Root and John Doench (Addgene #73633) was sub-cloned into the pMX-28 retroviral vector (Fig ...
-
bioRxiv - Molecular Biology 2023Quote: ... The AMPKγ1 mutant vector wherein Ser260 and Thr262 were replaced with alanine was created using parent-template backbone mouse AMPKγ1- full-length vector (# 15996, Addgene) and primers with the desired mutation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Dnmt3a CD and the C-terminal part of mouse Dnmt3L (3a3L) were amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827). The resulting constructs (collectively ...
-
bioRxiv - Developmental Biology 2024Quote: ... mouse vsv-plexin-B3 and human pECE-M2-BAIAP2 (IRSP53-Flag) were purchased from Addgene (#68038, #68039, #31656, USA).
-
bioRxiv - Cell Biology 2024Quote: ... shRNAs targeting luciferase or mouse Nr1h3 and Rara were cloned into the pLKO.1 vector (Addgene, MA, USA, #8453). The lentiviral vectors were co-transfected with the packaging vectors pCMV-deltaR8 (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN1 25 from pLentiCRISPRv2 (Addgene #52961) by lentiviral transduction ...
-
bioRxiv - Biophysics 2024Quote: ... pET3a aSyn murine plasmid containing a gene encoding mouse α-synuclein was a gift from Gabriele Kaminski Schierle (Addgene plasmid # 108865 ...
-
bioRxiv - Biophysics 2024Quote: ... pET3a aSyn murine plasmid containing a gene encoding mouse α-synuclein was a gift from Gabriele Kaminski Schierle (Addgene plasmid # 108865; http://n2t.net/addgene:108865; RRID:Addgene_108865).
-
bioRxiv - Pathology 2022Quote: ... tdTomato-WPRE-polyA sequence was obtained from the sequence of the targeting vector for Ai9 mouse (Addgene plasmid #22799) since the Ai9 mouse shares the same sequence for tdTomato-WPRE-polyA with the Ai14 mouse used in this study29 ...
-
bioRxiv - Molecular Biology 2024Quote: More than 140 million wild type Abl pre-B cells carrying inducible Cas9 transgene were transduced with a lentiviral gRNA library containing 90,230 gRNAs targeting over 18,000 mouse genes (Addgene, 67988) by spin-infection as described above ...
-
bioRxiv - Neuroscience 2024Quote: ... and GCaMP6f under the control of the GABAergic neuron-specific enhancer of the mouse Dlx (mDlx) gene (Addgene #83899)134 was transfected for imaging inhibitory interneurons as shown previously35 ...
-
bioRxiv - Genetics 2024Quote: ... Mouse Fignl1 sgRNA start and stop sequences (table below) were cloned into pSpCas9(BB)-2A-GFP (pX458) (Addgene #48138) at BbsI site ...
-
bioRxiv - Cell Biology 2024Quote: ... were recombined into intron 1 of the mouse Rosa26 locus using the targeting vector STOP-eGFP-ROSA26TV (Addgene #11739)56 ...
-
bioRxiv - Biochemistry 2021Quote: ... Electrocompetent cells were prepared from frozen cell stocks and transformed with the pFREE vector (Addgene plasmid #92050 ...
-
bioRxiv - Systems Biology 2020Quote: ... MDCKI + bPAC cells were generated by infecting MDCKI cells with pLenti-PGK-bPAC::NES (Addgene #130267). PKAc expressing cells were obtained by transfecting MDCKI and MDCKI + bPAC cells with pPB-CAG-PRKACA::mRuby2 (Addgene #130268) ...
-
bioRxiv - Immunology 2022Quote: ... KMS11-Cas9+ cells and LP1-Cas9+ cells (transduced with pLX 311-Cas9 construct, Addgene plasmid # 96924) were obtained from the Broad Institute ...
-
bioRxiv - Biochemistry 2024Quote: HEK293T cells or HepG2 cells were cultured and transfected with pCMVβ-p300-myc (Addgene, Cat# 30489), flag-HDAC3 (Addgene ...
-
bioRxiv - Molecular Biology 2020Quote: The gRNA sequence: 5’-TTAAAGAGTAACTACCAACT-3’ targeting the mouse Xpo7 gene was cloned into the PX459 plasmid (Addgene #62988, (23)) ...
-
bioRxiv - Cancer Biology 2020Quote: ... we designed single guide RNAs specifically targeting exon 1 of the mouse Bmal1 gene and subcloned it into the PX459 vector (Addgene) to obtain the PX459-Bmal1 plasmid ...
-
bioRxiv - Microbiology 2021Quote: The genome-scale CRISPR-Cas9 screen was performed using the mouse GeCKOv2 sgRNA library as previously described (Fig. 1A) (Addgene) [36] ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were infected at low viral titer with the pooled mouse CRISPR lentiviral library containing 78,637 gRNAs targeting 19,674 genes (Addgene #73633-LV). Infected cells were selected with puromycin (1 μg/ml ...
-
bioRxiv - Biophysics 2022Quote: ... The gene encoding mouse E1 was a kind gift from Jorge Eduardo Azevedo (Addgene plasmid 32534, (Carvalho et al., 2011)) ...
-
bioRxiv - Neuroscience 2020Quote: Full-length Susd4 mouse gene was cloned into the mammalian expression vector pEGFP-N1 (Addgene, Massachusetts, USA, Cat#6085-1) to express a SUSD4-GFP fusion construct under the control of the CMV promoter (pSUSD4-GFP) ...
-
bioRxiv - Immunology 2020Quote: ... The donor plasmid (pW290) used to target the endogenous mouse Wapl locus was constructed by modifying a published pMK290 plasmid (Plasmid #86230, Addgene). Briefly ...
-
bioRxiv - Neuroscience 2021Quote: The cDNA encoding for mouse neurofilament light chain (NFL) was amplified from the vector pmNFL (a gift from Anthony Brown, Addgene plasmid #83127 ...
-
bioRxiv - Genetics 2020Quote: The mouse Erk1 gene gRNA (GGTAGAGGAAGTAGCAGATG) and mouse Erk2 gene gRNA (GGTTCTTTGACAGTAGGTC and CTTAGGGTTCTTTGACAGT) were cloned into pX330 vector obtained from Addgene. The target vector and pEF1a-pac vector were co-transfected (5:1 ratio ...
-
bioRxiv - Immunology 2021Quote: The lentiviral gRNA plasmid library for genome-wide CRISPR-Cas9 screen (Mouse Improved Genome-wide Knockout CRISPR Library v2, Pooled Library #67988#) and mock vector (#67974) was obtained from Addgene. The library was amplified following the protocol provided by Addgene ...
-
bioRxiv - Developmental Biology 2020Quote: ... a FLAG-tag version of the codon-optimized mouse DUX was amplified by PCR (Primers in Extended Table 1) from pCW57.1-mDUX-CA (Addgene 99284) and subcloned into the pBS31 plasmid (pBS31-FLAG_mDUX) ...
-
bioRxiv - Neuroscience 2023Quote: Wild type (WT) and mutant variants of mouse p38γ were cloned into a pULTRA plasmid,42 a gift from Malcolm Moore (Addgene plasmid no ...