Labshake search
Citations for Addgene :
151 - 200 of 2254 citations for Mouse Cell Surface Hyaluronidase CEMIP2 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... we first amplified sgRNA sequences from an optimized mouse CRISPR knockout library lentiCRISPRv2-Brie (Addgene #73632). A total of eight 50 μL PCR reactions were performed to maximize coverage of sgRNA complexity ...
-
bioRxiv - Molecular Biology 2021Quote: Mouse FLAG-Sp7 or osteocrin cDNAs were introduced via lentivirus via pLX_311 backbone (Addgene, plasmid 118018) as previously described [21] ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mouse Improved Genome-wide Knockout CRISPR Library v2 was a gift from Kosuke Yusa (Addgene #67988) (Tzelepis et al ...
-
bioRxiv - Immunology 2021Quote: Full-length mouse and human NLRP3 were cloned into pLenti CMVie-IRES-BlastR (Addgene plasmid #119863). The resulting constructs were further modified by addition of N-terminal FLAG-tag followed by fluorescent protein mScarlet and Tobacco Etch Virus (TEV ...
-
bioRxiv - Molecular Biology 2021Quote: Notch1 and Jagged1 constructs were generated by polymerase chain reaction (PCR) using mouse Notch1 (Addgene 41728), human Notch1 (kind gift of Dr ...
-
bioRxiv - Cell Biology 2023Quote: ... Expression vectors for mouse PDGFRα and PDGFRβ were generated from pcDNA5FRT-EF-Pdgfra-EGFPN (Addgene #66787) and pcDNA5FRT-EF-Pdgfrb-EGFPN (Addgene #66787) ...
-
bioRxiv - Biochemistry 2023Quote: ... Mouse H2A.Z.1 gene in pIND-EGFP was a kind gift from from Danny Rangasamy (Addgene plasmid # 15770 ...
-
bioRxiv - Cell Biology 2023Quote: Mouse HA-Sox9-P2A and P2A-Cre blocks were PCR-amplified from pWPXL-Sox9 (Addgene, #36979) and AAV:ITR-U6-sgRNA(backbone)-TBG-Cre-WPRE-hGHpA-ITR(Katsuda et al. ...
-
bioRxiv - Cell Biology 2023Quote: Mouse HA-Sox4-P2A and P2A-Cre blocks were PCR-amplified from pLVXT-Sox4 (Addgene, #101121) and AAV:ITR-U6-sgRNA(backbone)-TBG-Cre-WPRE-hGHpA-ITR31 respectively ...
-
bioRxiv - Molecular Biology 2024Quote: ... The sensing domain for cAMP comprised residues of 199–358 of mouse Epac1 (Addgene plasmid #73938). The sensing domain for citrate comprised residues 4–133 of the CitAP domain from Klebsiella pneumoniae CitA protein (Addgene plasmid #134301) ...
-
bioRxiv - Cell Biology 2024Quote: ... Mouse wild-type Pcyt2 cDNA (Horizon Discovery, MMM1013-202763346) was cloned into N174-MCS (Addgene, 81061) backbone digested with EcoRI and BamHI (New England Biolabs ...
-
bioRxiv - Biochemistry 2024Quote: ... Lentiviral particles containing the sgRNA against mouse Rap1 (target: 5’-GCAGTCTAGGATGTACTGCG-3’) in lentiCRISPR v2 (Addgene plasmid # 52961 ...
-
bioRxiv - Neuroscience 2024Quote: ... we used pD454-SR mouse alpha-synuclein (Addgene plasmid, 89075; http://n2t.net/addgene:89075; RRID: Addgene_89075). Large 250 ml bacterial cultures were left overnight at 37°C with constant shaking at 600 rpm to allow for αSyn expression.
-
bioRxiv - Cancer Biology 2023Quote: The one-step multiplex CRISPR-Cas9 assembly system kit was a gift from Takashi Yamamoto (Addgene Kit #1000000055) (2 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... cerevisiae Advanced Gateway Destination Vector Kit (Addgene) were used to perform Gateway Cloning (69) ...
-
bioRxiv - Microbiology 2021Quote: ... which was obtained from Addgene (Kit #1000000137). Initially the aph coding sequence in pAJM.011 was replaced by the bla coding sequence ...
-
bioRxiv - Plant Biology 2022Quote: ... a modular cloning system was employed using MoClo Tool Kit and MoClo Plant Parts kit (Addgene, Supplemental Table S3) (Weber et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... These amplified parts were assembled with the parts from the Yarrowia lipolytica Golden Gate tool kit (Addgene kit #1000000167) by facilitating BsaI restriction sites ...
-
bioRxiv - Bioengineering 2024Quote: ... The pOSIP plasmid kit used for clonetegration was a gift from Drew Endy and Keith Shearwin (Addgene kit # 1000000035). Genomic modifications to E ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse Neurexin3α-(-S4) (cDNA gift from Ann Marie Craig’s lab) and rat Neurexin3β-(-S4) (cDNA from Addgene plasmid #58269 from Peter Scheiffele’s lab) ...
-
bioRxiv - Microbiology 2022Quote: Mouse Brie CRISPR knockout pooled library was a gift from David Root and John Doench (Addgene #73633) (42 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse SMO (gift from Gregory Pazour, UMass, Worcester, USA; plasmid no. 164532; Addgene (Desai et al., 2020)) ...
-
bioRxiv - Immunology 2022Quote: ... Mouse Brie CRISPR knockout pooled library was a gift from David Root and John Doench (Addgene #73633). The plasmid DNA pool was amplified as previously described (Doench et al ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... We utilized a well-functioning and validate genome-wide mouse lentiviral CRISPR guide RNA library v2 (Addgene). It consists of 90230 gRNA sequences directed against 18424 different genes across the mouse genome ...
-
bioRxiv - Cell Biology 2024Quote: ... mGreenLantern4 sequence and mouse Rab4A sequence (CCDS52703.1) were synthesized and cloned into a pT4 (Addgene#108352, RRID:Addgene_108352)-based Sleeping Beauty gene expression vector ...
-
bioRxiv - Cell Biology 2024Quote: ... mGreenLantern4 sequence and mouse Rab4A sequence (CCDS52703.1) were synthesized and cloned into a pT4 (Addgene#108352, RRID:Addgene_108352)-based Sleeping Beauty gene expression vector ...
-
bioRxiv - Physiology 2024Quote: ... the full-length cDNA of mouse MCM2 was amplified from mEmerald-MCM2-N-22 (Addgene ID: 54164) using forward primer ...
-
bioRxiv - Developmental Biology 2024Quote: ... mouse embryos were transduced with a high-titer lentivirus carrying an H2B-GFP reporter (Addgene plasmid #26777) and imaged after 24hrs using a confocal microscope.
-
bioRxiv - Systems Biology 2022Quote: ... and added undiluted to K562 cells for a final cell concentration of 3-4 x 105 cells/mL for pJT126-based effector recruitment vectors (Addgene #161926) or 1-2 x 105 cells/mL for pCL040-based inducible protein expression vectors (to be deposited on Addgene ...
-
bioRxiv - Plant Biology 2021Quote: ... the kit (Golden Gate TALEN and TAL Effector Kit 2.0) consisting of 86 library vectors was ordered from Addgene (www.addgene.org). To assemble the dTALe harboring 16 repeats ...
-
bioRxiv - Plant Biology 2020Quote: ... The following binary plasmids were assembled by Golden Gate cloning using the MoClo Tool Kit for plants (Addgene kit #1000000044) (Weber et al. ...
-
bioRxiv - Bioengineering 2022Quote: Cas9 and FE expression vectors were constructed using the pX330A and pX330S vectors contained in Multiplex CRISPR/Cas9 Assembly System Kit (Kit #1000000055, Addgene)48 with some modifications ...
-
bioRxiv - Cell Biology 2023Quote: ... The TRUPATH kit was purchased from Addgene (#1000000163) and was a gift from Bryan Roth ...
-
bioRxiv - Synthetic Biology 2023Quote: ... a gift from John Dueber (Addgene kit # 1000000061). The constructs encoding sequential incorporation of serine in place of tyrosine in the FUS IDR was based on previously published sequences66 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... a gift from Christopher Voigt (Addgene Kit #1000000137), were utilized in this study as PCR templates and/or intermediate DNA assembly hosts (19).
-
bioRxiv - Immunology 2021Quote: The mouse BRIE knockout CRISPR pooled library was a gift of David Root and John Doench (Addgene #73633) (36) ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse Mln and human REV-ERBα coding sequences were inserted into the pBabe plasmid (Addgene, Cambridge, Massachusetts, USA) by using BamHI-SalII restriction sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Mouse nAChR alpha4 CFP was a gift from Henry Lester (Addgene plasmid # 15244; http://n2t.net/addgene:15244; RRID:Addgene_15244). Human α3-nAChR-GFP was obtained from Sino Biological (HG29719-ACG) ...
-
bioRxiv - Cancer Biology 2021Quote: All human and mouse melanoma lines were engineered to overexpress Cre under the UBC promoter modified from Addgene plasmid #65727 as described in87 ...
-
bioRxiv - Immunology 2020Quote: The mouse BRIE knockout CRISPR pooled library was a gift of David Root and John Doench (Addgene #73633) (36) ...
-
bioRxiv - Neuroscience 2022Quote: ... and one CaMKII mouse was infused with AAV9-synapsin-SomArchon-GFP (titer: 5.9×1012 GC/mL, Addgene #126941). PV mice (n=9 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genetic depletion of mouse RhoA or AKT1 in vivo was conducted using pSECC (#60820; Addgene, Watertown, MA, USA), a lentiviral-based system that combined both the CRISPR system and Cre recombinase ...
-
bioRxiv - Cancer Biology 2023Quote: ... male mice were injected with 6.4 X 108 GC/mouse of AAV8.TBG.PI.Cre.rBG (AAV-TBG-Cre, Addgene, 107787-AAV8) diluted in 100μL PBS via the tail vein ...
-
bioRxiv - Cell Biology 2022Quote: ... a gRNA targeting exon three of mouse TOM1L2 (GCTCTAAAGAAGCGGCTTAG) was cloned into pX459V2.0-eSpCas9(1.1) (gift from Yuichiro Miyaoka; Addgene; plasmid no ...
-
bioRxiv - Neuroscience 2022Quote: ... the Adamts2 or TGFβR2 coding sequence was amplified by PCR using mouse Adamts2 and TGFβR2 ORF plasmids (pCMV-Adamts2, Harvard plasmid clones; pCMV-TGFβR2, Addgene) as templates ...
-
bioRxiv - Bioengineering 2024Quote: The Talin 1 rod domain R1-R2 (mouse talin1 482-786) was flanked between SNAP-tag (Addgene #101135) and HaloTag (Promega G8031) ...
-
bioRxiv - Molecular Biology 2024Quote: ... ESCs were co-transfected with a plasmid expressing Cas9 protein and the gRNA sequence targeting the NPM1 locus (pX330 Mouse 5’ Npm1 gRNA, a gift from Mark Groudine, Addgene plasmid #127900; http://n2t.net/addgene:127900; RRID:Addgene_127900) and the HDR donor plasmid derived from Mouse 5’ Npm1-AID-GFP-PuroR plasmid (a gift from Mark Groudine ...
-
bioRxiv - Biochemistry 2024Quote: ... pCMV5 mouse Src was a gift from Joan Brugge & Peter Howley (Addgene plasmid # 13663; http://n2t.net/addgene:13663 ; RRID:Addgene_13663). The mouse Src gene was subcloned into the pEGN Bacmam vector(45) ...
-
bioRxiv - Neuroscience 2024Quote: DIV14-16 Primary hippocampal mouse neurons were simultaneously transfected via combiMag and Lipofectamine with EB3-miRFP703 (Addgene #79994) and either NC-GFP (Origene TR30013 ...
-
bioRxiv - Neuroscience 2024Quote: ... mouse P2ry12 cDNA was subcloned into pCDH-EF1-copGFP-T2A-Puro (Addgene, 72263, a gift from Kazuhiro Oka) at EcoRI and BamHI sites ...