Labshake search
Citations for Addgene :
451 - 500 of 2254 citations for Mouse Cell Surface Hyaluronidase CEMIP2 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... 293T packaging cells were transfected with psPAX2 (Addgene 12260), pMD2.G (Addgene 12259 ...
-
bioRxiv - Cell Biology 2020Quote: HEK293 cells were transfected with pMIB1-FLAG (Addgene# 37116) and pHA-Ub (Addgene# 18712 ...
-
bioRxiv - Cell Biology 2020Quote: ... KO cells were generated using either px330 (Addgene #42230) or pLentiCRISPRv2 (Addgene #52961) ...
-
bioRxiv - Cell Biology 2021Quote: ... U2OS cells were transfected with GFP-Sec61β (Addgene, 15108) using FuGENE6 (Promega) ...
-
bioRxiv - Genetics 2020Quote: ... and cells were nucleofected with Cas9-GFP (Addgene #44719), a gBlock (IDT ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli S2060 cells were prepared containing pJC175e (Addgene #79219), a plasmid expressing pIII under control of the phage shock promoter32 ...
-
bioRxiv - Cancer Biology 2020Quote: We infected cells with pCW-Cas9 plasmid (Addgene #50661) and selected cells with puromycin at 2 μg/mL ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were transfected with GFP-tagged galectin 3 (Addgene) or a mutant variant of it ...
-
bioRxiv - Cell Biology 2020Quote: ... we transfected HEK293T cells with FUW-OSKM (Addgene #20328) and packaging vectors using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells transduced with lentivirus carrying KRAB-dCas9 (Addgene #71236) and sgRNAs were harvested one week after the transduction ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells with pMD2.G and psPAX2 packaging plasmids (Addgene) to create VSV-G pseudotyped lentiviral particles ...
-
bioRxiv - Cancer Biology 2022Quote: HEK293T cells were transfected with lentiCRISPRv2 (Addgene Plasmid #98290), the above dual sgRNA constructs ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4292 cells were infected with lentiCas9-Blast (Addgene #52962). Following blasticidin selection ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were transfected with plasmids phCMV-10A1 (Addgene #15805), pBS- CMV-gagpol (Addgene #35614 ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were transfected with WT RNase H1 (Addgene, 111906), the D210N mutant (Addgene ...
-
bioRxiv - Genomics 2020Quote: ... K562 cells were transduced with lentiCas9-Blast (Addgene 52962) at a multiplicity of infection (MOI ...
-
bioRxiv - Neuroscience 2021Quote: ... which is general to mammalian cells (AAV1.CAG.Flex.GCaMP6f.WPRE.SV40, Addgene), at DIV 3 ...
-
Interleukin 4 controls the role of macrophages in pulmonary metastatic tumor cell seeding and growthbioRxiv - Cancer Biology 2021Quote: ... The fluorescent E0771-LG cell line expressing Clover (Addgene) [57] used in intravital experiments was established by standard transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293T cells were transfected with pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and AdEasier-1 cells (#16399) were purchased from Addgene. Full length Rela gene was inserted into pShuttle-CMV with SalI and NotI to obtain pShuttle-CMV-Rela ...
-
bioRxiv - Cell Biology 2022Quote: ... Control cells were generated using pLenti.Cas9-blast (Addgene, #52962) and the non-targeting control gRNA (Addgene ...
-
bioRxiv - Microbiology 2022Quote: HEK293T cells were transfected with pVSV-G (Addgene #138479), psPAX2 (Addgene #12260) ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293T cells were co-transfected with pMDL (Addgene #12251), pREV (Addgene #12253) ...
-
bioRxiv - Cancer Biology 2023Quote: ... or the cell cycle marker PIP-FUCCI (Addgene #118616). Transduced cells were selected by FACS sorting.
-
bioRxiv - Molecular Biology 2023Quote: ... Cell lines were transduced with lentiCas9-Blast13 (Addgene, #52962) and selected with 20 µg/ml blasticidin to generate stable CAS9-expressing cell lines ...
-
bioRxiv - Immunology 2023Quote: ... Cells were transfected with 0.25 pRSV-Rev (Addgene, 12253), 0.53 µg pMDLg/pRRE (Addgene ...
-
bioRxiv - Bioengineering 2022Quote: ... cells were transfected with lifeact–GFP (Addgene plasmid 15238) using Lipofectamine 3000 transfection kit (Invitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: ... A549 cells were transfected with px459-Cas9 plasmid (Addgene), carrying sgRNA for YTHDC1 “ATTCTTATAAGGTTCTCTGG” ...
-
bioRxiv - Immunology 2024Quote: ... Cells were transfected with 0.25 pRSV-Rev (Addgene, 12253), 0.53 µg pMDLg/pRRE (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: Transfection of HEK293T cells with pHis-Ubiquitin (Addgene, 31815) was performed by the calcium phosphate-DNA precipitation method 66 ...
-
bioRxiv - Genetics 2023Quote: ... by co-transfecting cells with TALEN-L (Addgene #35431), TALEN-R (Addgene #35432 ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were transfected with the PX458 plasmid (Addgene 48138) containing the guide sequence (CTTGGTATCGAAGCACAAGC or ACTTTGCAGCCGTCATCGGG ...
-
bioRxiv - Biochemistry 2023Quote: ... HEK293T cells were transfected with pMD2.G (Addgene #12259), psPAX2 (Addgene #12260) ...
-
bioRxiv - Cancer Biology 2023Quote: ... U-937 cells were transfected with pCDM8 hCD8121 (Addgene) using the Amaxa Nucleofactor II ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were infected with pACAGW-ChR2-Venus-AAV9 (Addgene). 0.5 ul were added to 500 ul differentiation medium ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transfected with 4.3 μg psPAX2 (Addgene; 12260), 0.43 μg pCMV-VSV-G (Addgene ...
-
bioRxiv - Microbiology 2023Quote: 293T cells were transfected with pCMV-VSV-G (Addgene) expressing VSV-G or pEF4/HisA (Thermo ...
-
bioRxiv - Cancer Biology 2022Quote: ... HEK293T cells were transiently transfected with psPAX2 (Addgene #12260), PMD2.G (Addgene #12259 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were transfected with pCas9-GFP (Addgene plasmid #44719), pBR322-U6-hPAX3-gRNA-S1 containing sgRNA CCGGCCAGCGTGGTCATCCT and repair template p15A-cm-hPAX3-Venus-neo-1kb containing a Venus-neo cassette with 1 kb hPAX3 homology arms ...
-
bioRxiv - Systems Biology 2023Quote: ... pSLIK 3xFLAG-Luciferase zeo (for B2B1 cells; Addgene #136533) or pSLIK 3xFLAG-LacZ neo (for TM15c6 cells ...
-
bioRxiv - Cell Biology 2024Quote: HEK293T cells were co-transfected with psPAX2 (Addgene #12260), VSV.G (Addgene #14888) ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transiently transfect with BFP-KDEL (Addgene, 49150) and imaged 48 hr later ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were transfected with pEGFP-H1.1 plasmid (Addgene, 32894) using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Molecular Biology 2024Quote: ... HEK-293T cells were transduced with LentiCRISPR_V2 vectors (Addgene plasmid 52961 ...
-
bioRxiv - Immunology 2024Quote: ... cells were co-transfected with pcDNA-mGATA3 (#1332, Addgene) and MSCV-mGfi1-IRES-GFP expression plasmids ...
-
bioRxiv - Cancer Biology 2024Quote: shMAFG cells were generated using pLKO.1 (Addgene; 10878) cloned with shRNA sequences (Supplementary Table ...
-
bioRxiv - Biochemistry 2024Quote: ... cells were transfected with pSFFV_mNG3K (1-10) (Addgene #157993). 36 hours after transfection ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were transfected with pEGFP-hGABARAP Plasmid (Addgene, 87871) for overexpression by using Lipofectamine 3000 according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were transfected with pMSCVpuro-Cre plasmid (Addgene #34564). Cells were then treated with puromycin (Fisher Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: ... cells were transformed with p-GloMyc-Klf4 (AddGene 172870) and the empty vector control pcDNA-3.1 (Invitrogen V79020) ...