Labshake search
Citations for Addgene :
201 - 250 of 10000+ citations for Carboxypeptidase Y from Baker's Yeast since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... were acquired from Addgene. The CDS of Cdh1 was amplified from Addgene 71366 and moved into the BstBI and NotI sites of pCDH-CMV-MCS-EF1α-Neo ...
-
bioRxiv - Neuroscience 2020Quote: ... was purchased from Addgene. AAV plasmids for DREADD viruses were purchased from Addgene (Table S1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... was acquired from Addgene. The pTXB1 Tn5 and its mutant were expressed and purified mainly according to the protocol published by Picelli S et al ...
-
bioRxiv - Biochemistry 2021Quote: ... was purchased from Addgene Inc ...
-
bioRxiv - Neuroscience 2020Quote: ... from Pyronic/pcDNA3.1(-) (Addgene# 51308 ...
-
bioRxiv - Bioengineering 2020Quote: ... are available from Addgene. Incubate BTV with XhoI & XmaI and CTV with BamHI & XhoI for 4 h at 37°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... were purchased from Addgene.
-
bioRxiv - Neuroscience 2021Quote: ... were obtained from Addgene.
-
bioRxiv - Molecular Biology 2021Quote: ... were obtained from Addgene. The IRES-Puro elements in the above plasmids were replaced with IRES-TagBFP from TRE-KRAB-dCAS9-IRES-BFP (Addgene ...
-
bioRxiv - Immunology 2021Quote: ... were obtained from Addgene, and have been validated for expression previously53 ...
-
bioRxiv - Biophysics 2022Quote: ... was obtained from Addgene. The HIV-1 Env plasmid ...
-
bioRxiv - Microbiology 2023Quote: ... were obtained from Addgene and amplified according to provided instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... were obtained from Addgene.
-
bioRxiv - Biophysics 2023Quote: ... was acquired from Addgene (gift from Katharina Gaus ...
-
Identification of resistance mechanisms to small-molecule inhibition of TEAD-regulated transcriptionbioRxiv - Cancer Biology 2023Quote: ... vectors were from Addgene. Cells were virally transduced with lenti-Cas9-2A-Blast and selected with Blasticidin-S (3µg/ml ...
-
bioRxiv - Bioengineering 2023Quote: ... were obtained from Addgene. The Csy3-VPR-Csy4 plasmid was digested with MluI (NEB ...
-
bioRxiv - Genetics 2023Quote: ... from pCFJ1663 (Addgene ID51484). Overlapping PCR was used to fuse both HygR fragments ...
-
bioRxiv - Neuroscience 2023Quote: ... was obtained from Addgene, and the PAX6 guideRNA (5’ GGCCAGTATTGAGACATATC 3’ ...
-
bioRxiv - Immunology 2023Quote: ... were purchased from Addgene. CAS9 Blasticidin Lenti plasmid was purchased from Sigma (CAS9BST) ...
-
bioRxiv - Genetics 2023Quote: ... was obtained from Addgene. Mouse Atrx sgRNAs were designed using Benchling (https://www.benchling.com/) ...
-
bioRxiv - Neuroscience 2023Quote: ... were obtained from Addgene (catalog #50465 and #100837 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Also obtained from Addgene was a plasmid expressing a surface charge probe containing a series of arginine residues linked to a prenylation signal fused with GFP R(+8)-prenyl-GFP (#17274).
-
bioRxiv - Neuroscience 2022Quote: ... were purchased from Addgene. pAAV-CaMKII-NPTX2-V5 were generated using NEBuilder HiFi DNA assembly cloning kit (Cat.E5520S) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... was amplified from Addgene plasmid #60955 and cloned into a PiggyBac recipient vector ...
-
bioRxiv - Neuroscience 2022Quote: ... plasmid #50465 from Addgene) were injected into the LHb (1.0 μL/site ...
-
bioRxiv - Molecular Biology 2022Quote: ... were purchased from Addgene. To generate pLentiCas9 (H840A)-Blast vector ...
-
bioRxiv - Synthetic Biology 2024Quote: ... eCFP (from Addgene #117209) into an XhoI-digested piggyBac vector containing also an attB site ...
-
bioRxiv - Biochemistry 2024Quote: ... were ordered from Addgene. Grasp55-GFP/G2A and Grasp55-GFPΔPDZ1 +2 were generated using site directed mutagenesis ...
-
bioRxiv - Physiology 2024Quote: ... were obtained from Addgene. pAAV7-DJ-CMV-TeNT-P2A-GFP was prepared and obtained through the Stanford Viral Core ...
-
bioRxiv - Neuroscience 2024Quote: ... or ordered from Addgene. pAAV_synP.DIO.EGFP ...
-
bioRxiv - Cell Biology 2024Quote: ... were obtained from Addgene. To knockout Deaf1 ...
-
bioRxiv - Cell Biology 2023Quote: ... was obtained from Addgene, and HaloTag was then inserted in place of mCherry to produce pET24a-VHH-HaloTag ...
-
bioRxiv - Molecular Biology 2023Quote: ... were obtained from Addgene. All gRNAs were designed and cloned previously as described in pLKO5.sgRNA.EFS.GFP vector (Addgene #57822)(Ravi et al ...
-
bioRxiv - Cell Biology 2024Quote: ... were obtained from Addgene. Primer sequences are listed in Supplementary Table 1.
-
bioRxiv - Microbiology 2023Quote: ... was obtained from Addgene (catalog number ...
-
bioRxiv - Immunology 2023Quote: ... were obtained from Addgene. Base editors were cloned into the IVT template vector using NEBuilder® HiFi DNA Assembly Cloning Kit (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... were purchased from Addgene, and the cDNAs encoding the PIK3CA- E545K and myrAKT1 alleles were subcloned into pLV-EF1a-IRES-Puro via Gibson assembly.
-
bioRxiv - Biophysics 2023Quote: ... also procured from Addgene (plasmid ID ...
-
bioRxiv - Cell Biology 2023Quote: ... were purchased from Addgene. All plasmid constructs were validated through Sanger didexoy sequencing (ACGT ...
-
bioRxiv - Neuroscience 2023Quote: ... both available from Addgene (Plasmids #100844 and #100843 respectively ...
-
bioRxiv - Bioengineering 2023Quote: ... were purchased from Addgene. p3xFlag-CMV-10 was a gift from Dr ...
-
bioRxiv - Neuroscience 2022Quote: ... W3SL is from Addgene_61463 ...
-
bioRxiv - Neuroscience 2022Quote: ... were obtained from Addgene. Each XFP gene was PCR-amplified and subcloned into pBS-TRE or pAAV-TRE vector 12 ...
-
bioRxiv - Molecular Biology 2022Quote: ... were obtained from Addgene. The GFP-UAG-BoxB-mCherry was generated by inserting the UAG-BoxB cassette into pcDNA5-EGFP-NLS-P2AT2A-mCherry-PTS1 (Addgene #87828 ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... all sourced from Addgene) under isoflurane anesthesia ...
-
bioRxiv - Cancer Biology 2022Quote: ... were obtained from Addgene. The human codon-optimized TEAD3 coding sequence with N-terminal Myc tag was synthesized as a gBlock (Integrated DNA Technologies) ...
-
bioRxiv - Cell Biology 2022Quote: ... were ordered from AddGene. The plasmid for JIP3 was a gift from Cavalli lab (Valeria Cavalli ...
-
bioRxiv - Cell Biology 2022Quote: ... was purchased from Addgene and subcloned to pGEX6P1 for improved induction ...
-
bioRxiv - Cell Biology 2022Quote: ... was purchased from Addgene. pLVX TRE 3G and pLVX EF1Į Tet3G were part of Tet-On® 3G Inducible Expression Systems (631363 ...
-
bioRxiv - Immunology 2022Quote: ... was obtained from Addgene (Addgene # 73632 ...