Labshake search
Citations for Addgene :
1 - 50 of 10000+ citations for Carboxypeptidase Y from Baker's Yeast since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... was amplified from plasmid pYTK047 from the Yeast ToolKit (Addgene, Kit#1000000061) [26] ...
-
bioRxiv - Microbiology 2020Quote: ... The MoClo Yeast Toolkit25 was obtained from Addgene (Kit # 1000000061) and was a gift from Prof ...
-
bioRxiv - Bioengineering 2022Quote: ... pAG423GAL-ccdB-eGFP plasmid for yeast expression was obtained from Addgene[28] ...
-
bioRxiv - Molecular Biology 2024Quote: For yeast transformation the plasmid pJW1666 (gift from Jonathan Weissman (Addgene plasmid # 112040 ...
-
bioRxiv - Neuroscience 2022Quote: ... The Gal4 cDNA/hsp70 yeast terminator sequence was amplified from pBPGuW (Addgene). A donor plasmid was generated by combining a 1,050-bp left homology arm ...
-
bioRxiv - Genomics 2020Quote: ... Yeast-optimized yECitrine coding sequence was amplified from pNTI189 (pKT0139 AddGene #8731) (54 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Yeast Toolkit plasmids were a gift from John Dueber (Addgene kit # 1000000061). pAJ4619 was made from pAJ4618 by inverse PCR using oligos AJO3551 and AJO3539 ...
-
bioRxiv - Biophysics 2021Quote: The plasmid containing yeast (Saccharomyces cerevisiae) Ubr1 was purchased from Addgene (plasmid # 24506) 41 ...
-
bioRxiv - Genetics 2022Quote: Yeast transformed with the plasmid FLII12Pglu-700μδ6 (pSL590, [a gift from Wolf Frommer: Addgene #28002 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and p426-SNR52p-gRNA.CAN1.Y-SUP4t (Addgene# 43803). The LEU2 marker was replaced with the SpHIS5 marker by homologous recombination in yeast ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmids pYFAC-ubi-Y-pyrG (Addgene ID# 184497), pYFAC-ubi-M-pyrG (Addgene ID# 184498 ...
-
bioRxiv - Genetics 2020Quote: ... These plasmids were constructed through multiple rounds of cloning using DNA fragments from yeast DNA or plasmids acquired from Addgene (kind gifts from John McCusker ...
-
bioRxiv - Cell Biology 2020Quote: Control plasmid encoding Sec61β-APEX2 (https://www.addgene.org/83411) was obtained from Addgene (S. Y. Lee et al., 2016) and APEX2-KDEL was generated by adding KDEL-encoding gene sequence to the 3’ reverse primer ...
-
bioRxiv - Synthetic Biology 2020Quote: ... A synthetic toolkit (MoClo-YTK) containing yeast parts were gifts from the Dueber Lab (Addgene #:1000000061). Characterization plasmids consisted of 8 parts ...
-
bioRxiv - Molecular Biology 2022Quote: ... yeast expression constructs for nuclease-inactivated Cas9 (D10A/H840A mutations) from Streptococcus pyogenes –dCas9 (Addgene #46920) (Gilbert et al 2013 ...
-
bioRxiv - Bioengineering 2023Quote: A synthetic toolkit (MoClo-YTK) containing yeast parts were gifts from the Dueber Lab (Addgene #1000000061). Expression vectors for yeGFP ...
-
bioRxiv - Cell Biology 2024Quote: ... This cassette was sourced from a Yeast Deletion Library (Dharmacon) or from the pFA6a-yo-linkEGFP-KanMX plasmid (Addgene Plasmid #44900) (114).
-
bioRxiv - Bioengineering 2023Quote: ... and p426-SNR52p-gRNA.CAN1.Y-SUP4t (Addgene plasmid # 43803) were a gift from George Church and were used as the backbone plasmids for all studies (25) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and p426-SNR52p-gRNA.CAN1.Y-SUP4t plasmid (Addgene #43803). Constitutive expression of Cas9 is driven by the TEF1 promoter and constitutive expression of the gRNA is driven by the SNR52 promoter ...
-
bioRxiv - Biochemistry 2024Quote: ... Construct encoding yeast NDI1 retroviruses (Addgene #72876) has been previously described63 ...
-
bioRxiv - Immunology 2021Quote: ... Yeast scFv display libraries were generated using the amplified VH and VL DNA libraries from above and the pYD1 yeast surface display vector (Addgene plasmid #73447; https://www.addgene.org/73447/; RRID:Addgene_73447) (60) ...
-
bioRxiv - Biochemistry 2022Quote: ... To produce recombinant CK2 kinase the CKA2 gene was PCR amplified from yeast cDNA library and cloned into a pOPINF vector (a kind gift from Ray Owens, Addgene plasmid 26042) to encode a 3C-cleavable His6 fusion protein ...
-
bioRxiv - Molecular Biology 2024Quote: For yeast transformation the plasmid pJW1666 (gift from Jonathan Weissman (Addgene plasmid # 112040 ; http://n2t.net/addgene:112040 ; RRID:Addgene_112040(103)) was used to clone the WT or mutant QKI sequences ...
-
bioRxiv - Molecular Biology 2020Quote: ... FET4 was cloned with ∼400bp of the upstream promoter into the pAG425 (resulting plasmid named pBMW182a) backbone using the Yeast Gateway System Vectors (obtained from Addgene) (Alberti et al. ...
-
bioRxiv - Immunology 2021Quote: ... Yeast scFv display libraries were generated using the amplified VH and VL DNA libraries from above and the pYD1 yeast surface display vector (Addgene plasmid #73447 ...
-
bioRxiv - Cell Biology 2020Quote: ... and further into pAG423Gal-ccdB (high copy yeast expression plasmid) and pAG413Gal-ccdB (low copy yeast expression plasmid) vectors (Addgene plasmid #14149 and 14141) through standard Gateway Cloning protocol ...
-
bioRxiv - Genomics 2020Quote: ... Plasmid pOsTIR1w/oGFP (for integrating the Oryza sativa TIR1 gene into the HO locus in yeast) was purchased from Addgene (Watertown, Massachusetts). pMK152 plasmid (for degron tagging CDC19 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The resulting pENTRY-CHEK2stop-BamHI variants were then cloned into the yeast vector pAG414GAL (a gift from Susan Lindquist; Addgene plasmid # 14143) using the LR reaction ...
-
bioRxiv - Biochemistry 2022Quote: The NLS-Keima-luciTS plasmid was constructed by replacing the GFP moeity with yeast optimized Keima using a cassette amplified from plasmid pFA6a-link-yomKeima-Kan (Addgene plasmid #44902) with the oligonucleotides 5’ATGGCTTCTCCTAAGAAGAAACGTAAAGTTATGGTTTCTGTGATCGCTAAACAAAT GAC and 5’CCATGCAAGCTTGCGCGGATCCGCGCCCTAATAGAGAATGTCTTGCGATAGC ...
-
bioRxiv - Microbiology 2020Quote: ... provided as part of the Yeast MoClo Toolkit (AddGene ID # 65143)54.
-
bioRxiv - Evolutionary Biology 2024Quote: The destination plasmids were made by modification of the pAG415-GAL-ccdB-EGFP and pAG415-GAL-EGFP-ccdB from the Yeast Gateway kit (1000000011, Addgene, (Alberti, Gitler et al. 2007)) to create two new plasmids (pARC0031 and pARC0152 ...
-
bioRxiv - Biochemistry 2022Quote: ... yeast expression vector while HsTOP2β was inserted into the 12URA-C (Addgene #48305) yeast expression vector using Ligation Independent Cloning (LIC) ...
-
bioRxiv - Systems Biology 2020Quote: ... Yeast competent cells were co-transformed with a pCAS plasmid (Addgene plasmid 60847, (46)) expressing both the gRNA of interest and Streptococcus pyogenes Cas9 and a donor DNA sequence (stuffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... and RRP46_589.gRNA with AC9888 and AC6809 using p426-SNR52p-gRNA.CAN1.Y-SUP4t plasmid template (Addgene #43803) and cloning of SphI/KpnI-digested gRNA products into pAC3846 digested with SphI/KpnI ...
-
bioRxiv - Molecular Biology 2023Quote: ... and SNR52p with AC6804 and AC6805 using p426-SNR52p-gRNA.CAN1.Y-SUP4t plasmid template (Addgene #43803, [87]), followed by sequential cloning of SacI/SpeI-digested TEF1p ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The plasmid for heterologous expression with alcohol inducible promoters pYFAC-CH2-ubi-Y-pyrG (Addgene ID# 221131) and pYFAC-CH2-ubi-M-pyrG (Addgene ID# 221132 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... https://github.com/desai-lab/compensatory_epistasis_omicron/tree/main/Supplementary_Files) into pETcon yeast surface-display vector (plasmid 2649; Addgene, Watertown ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... MYO3 and MYO5 SH3-deleted yeast competent cells were co-transformed with pCAS (Addgene plasmid 60847) containing the stuffer-specific gRNA and Streptococcus pyogenes Cas929 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... MYO3 and MYO5 SH3-deleted yeast competent cells were co-transformed with pCAS (Addgene plasmid 60847) containing the stuffer-specific gRNA and Streptococcus pyogenes Cas9 with the PCR amplified MYO3 and MYO5 SH3 single position mutated libraries from the pUC19 preparations acting as the donor DNA29 ...
-
bioRxiv - Bioengineering 2023Quote: ... The Sp sgRNA plasmids were obtained through PCR- site directed mutagenesis of p426- SNR52p-gRNA.CAN1.Y-SUP4t (Addgene 43803) to introduce the target sequences ...
-
bioRxiv - Genetics 2020Quote: ... The yeast were then transformed with 100 ng of CRISPR-Swap plasmid (pFA0055-gCASS5a, Addgene plasmid # 131774) and 1 μg of DNA repair template amplified either from BY ...
-
bioRxiv - Developmental Biology 2020Quote: ... To generate CRISPR Cas9 knockout mESC lines we transfected wild-type (for Srpk1 and Srpk2) or Rlim-/y (for Zfp42) mESCs with pX335 and pKN7 vectors (Addgene) containing gRNA sequences targeting ...
-
bioRxiv - Immunology 2020Quote: ... The yeast vector was generated by modification of the commercially available pCTcon2 vector (Addgene; Chao et al., 2006). The mutant N-CSP insert was cloned with N-terminal V5 and C-terminal HA epitope tags ...
-
bioRxiv - Microbiology 2022Quote: ... residues 336-528] yeast surface expression was established using Saccharomyces cerevisiae EBY100 strain and pJYDC1 plasmid (Addgene, Cat# 162458) as previously described22 ...
-
bioRxiv - Neuroscience 2023Quote: ... method into pDONR221 entry vector and then recombined into a yeast low-copy number CEN destination vector (Addgene, 70) to obtain pAG413-promGPD-WDR47 (pSF634) ...
-
bioRxiv - Systems Biology 2023Quote: ... we disrupted the endogenous LEU2 gene in Yα1867 yeast using the M3926 leu2::KanMX3 disruptor converter plasmid with G418 resistance (Addgene). M3926 was digested with BamHI (New England Biolabs ...
-
bioRxiv - Bioengineering 2023Quote: A DNA sequence encoding the CD47 Ig-like domain (Gln19 – Ser135) was cloned into the pCTCON2 yeast-surface display vector (Addgene) using the NheI and BamHI sites ...
-
bioRxiv - Bioengineering 2023Quote: ... pSNR52-BsmBI-Cj_sgRNA for gRNA expression in yeast was generated by substituting the promoter in the pU6 Cj sgRNA plasmid (Addgene 89753) with the SNR promoter by double digestion with XhoI and BamHI ...
-
bioRxiv - Microbiology 2023Quote: ... and subsequently assembled by yeast [Saccharomyces cerevisiae strain EBY100 (ATCC, Cat# MYA-4941)] homologous recombination with pJYDC1 plasmid (Addgene, Cat# 162458) as previously described1,5,18,19,55.
-
bioRxiv - Immunology 2024Quote: ... each RBD variant was tagged with a unique 26-nucleotide (N26) barcode via PCR and assembled into Yeast surface display vector (Addgene, 166782). The XBB.1.5 and JN.1 DMS libraries were further transfected into electrocompetent DH10B cells for plasmid amplification and proceed to PacBio sequencing library preparation to decipher the association between RBD variant and corresponding N26 barcode ...