Labshake search
Citations for Addgene :
151 - 200 of 1005 citations for rno mir 32 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... reverse primer: 5’ – GAGTCGggatccACTAGTAGTTCCTGCTATGTCACTTCCCCTTGG – 3’) and ligating the domain into the pUC19 cloning vector (Addgene plasmid # 50005), using the T4 ligase ligation kit (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... and hTATSF1 (amplified from K562 cDNA prepared using oligo(dT) primers) ORFs respectively into pLIX_403 (Addgene # 41395). Viral preps and selection were done as in previous section ...
-
bioRxiv - Developmental Biology 2023Quote: ... tbb-2 sequence was amplified using primers RA1792 and RA1793 and cloned into pPD95.75 (Addgene plasmid #1494) digested with EcoRI and SpeI using the NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Genetics 2021Quote: ... Cas9 and dCas-VP64 Calu-3 knock-in lines were then transduced with Brunello and Calabrese Set A libraries (Addgene #73179 and #92379) as appropriate ...
-
bioRxiv - Cancer Biology 2023Quote: HT29 dCas9-VP64 clone E cells were transduced with lentivirus of Calabrese pooled human CRISPRa library set A and B (Addgene, 92379 and 92380) separately ...
-
bioRxiv - Neuroscience 2023Quote: ... anesthetized RiboTag RT +/+ mice were bilaterally injected with AAV5-Cre viruses (AAV sterotype 5 AAV5.hSyn.HI.eGFP-Cre.WPRE.SV40 (Addgene; #105540) at the following coordinates ...
-
bioRxiv - Cell Biology 2021Quote: ... The resulting scFv fragments were further amplified using the 5’ and 3’ primers (scFv primer_s and scFv primer_as) and cloned into the psfGFP-N1 vector (Addgene #54737 ...
-
bioRxiv - Biophysics 2020Quote: We amplified OsTIR1 from pMK232 100 via PCR with the primers Cloning_OsTIR1_fw and Cloning_OsTIR1_rev and inserted it into the pLenti backbone from pLenti-CMV-rtTA3 (Addgene plasmid #26429) by digestion with BstXI ...
-
bioRxiv - Neuroscience 2020Quote: ... Lin Tian)56 using Q5 polymerase (primers: 5’-aaaagctagcatgaagacgatcatcgccctgagc-3’ and 5’-aaaaaggcgcgcctcaggttgggtgctgaccg-3’) and subcloned into pAAV.CBA.DIO (Addgene #81008)108 backbone between AscI and NheI restriction sites ...
-
bioRxiv - Microbiology 2019Quote: ... using published primers “M13/pUC Forward” (CCCAGTCACGACGTTGTAAAACG) and “L4440 Reverse” (AGCGAGTCAGTGAGCGAG) (Addgene plasmid # 1654; http://n2t.net/addgene:1654; RRID:Addgene_1654). Sequences were analyzed in Serial Cloner (v2.6 ...
-
bioRxiv - Cell Biology 2020Quote: ... using the primers GCTAGAATTGACCGGATGAGGAGAAGTGAGGTGCTG (FWD) and CATGGTGGCGACCGGTAAATTCGAAGCTTGAGCTCGAGATCTGAGGGACTGGATGTTGGTTGAATTGAGG (REV) and inserted into plasmid tgRFPt-SspB WT (Addgene number: 60415) (Guntas et al. ...
-
bioRxiv - Genetics 2020Quote: The primers ABEmax-F/ABEmax-R and AncBE4max-F/ AncBE4max-R was used to amplified pCMV_ABEmax_P2A_GFP (Addgene #112101) and pCMV_AncBE4max (Addgene #112094 ...
-
bioRxiv - Genomics 2020Quote: ... we amplified Ultramers with primers containing sequence homologous to either the STARR-seq luciferase validation vector_mP_empty (Addgene# 99298) or pGL4.23 (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... using primer 1008F and 1007R and cloning it into AgeI and FseI sites of pLdCH (Addgene #84291, (7)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... using pLenti_mENPP1_fwd and pLenti_mENPP1_rev primers in Table S1 and inserted into the XbaI-BamHI sites of pLenti-CMV-GFP-Puro (Addgene). To clone pLenti-CMV-mENPP1-T238A-GFP-Puro plasmid ...
-
bioRxiv - Molecular Biology 2021Quote: ... was PCR-amplified from plasmid pKIR1.1 (Addgene). Venus codon-optimized for expression in C ...
-
bioRxiv - Immunology 2020Quote: ... we PCR amplified TagRFP-Flag-cGAS (Addgene) by using RFP-cGAS-XbaI-F and cGAS-XhoI-R primers (Table S1) ...
-
bioRxiv - Cancer Biology 2023Quote: ... YAP5SA was amplified by PCR from Addgene #33093 ...
-
bioRxiv - Biophysics 2023Quote: FUS was PCR-amplified from pDEST8_FLAGHA_FUS_HIS (Addgene plasmid no ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human Sin1.1 was PCR-amplified from Addgene 73388 plasmid (gift from Taekjip Ha32 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and Gibson-assembled with the HaloTag gene amplified with primers HaloTag_F and HaloTag_R (Table 1) and pFA6a-HaloTag-KanMX6 (Addgene #87029) as a template ...
-
bioRxiv - Bioengineering 2020Quote: ... VPR was amplified by primer pair VPR-F/R (template source: pWalium20-10XUAS-3XFLAG-dCas9-VPR (Addgene No.: # 78897)(Lin et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... The NANOS3 gRNA expression cassettes driven by HU6 and ZU6 promoters were generated in the same manner using primer pair HU6(AgeI)_F and HU6_Nanos3gRNA(NheI)_R with gRNA_GFP-T2 (Addgene # 41820) plasmid as template DNA and primer ZU6_F1 and ZU6_Nanos3gRNA(NheI)_R with pDestTol2pA2-U6:gRNA (Addgene # 63157 ...
-
bioRxiv - Cell Biology 2021Quote: ... Sequence analysis and primer design was done in Benchling [68] All of the plasmids were from Addgene (Watertown, MA) and primers (Table S2 ...
-
bioRxiv - Cell Biology 2019Quote: ... All gRNA plasmids were generated with primers listed in Supplementary Table 5 (IDT) and integrated into pX330 (Addgene #42230) vector using Zhang Lab General Cloning Protocol 29 ...
-
bioRxiv - Genomics 2020Quote: ... complete the Illumina sequencing primer sequences and add 15 bp of sequence homologous to the hSTARR-seq (Addgene #99292) plasmid for InFusion cloning ...
-
bioRxiv - Biochemistry 2024Quote: ... The cDNA of APLF full length and APLFΔFHA and APLFΔAD were amplified with respective primer pairs (Table S1) and subcloned into Flag-HA-pCDNA3.1 (Addgene #52535) (Horn et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... its shorter isoform has been amplified from IMR90 cDNA with specific primers and cloned in pcDNA3.1(+) vector (purchased from Addgene). For overexpression studies ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-ALFA nanobody fragment was amplified using primers s15 and s16 (Table 3) from its expression vector (Addgene #189755). A pET24a-VHH-std vector (Addgene #109417 ...
-
bioRxiv - Cell Biology 2021Quote: ... Rtn4b-HaloTag was generated by inserting PCR-amplified Rtn4b from Rtn4b-GFP and PCR-amplified HaloTag from pSEMS-Tom20-HaloTag (Addgene plasmid #111135 ...
-
bioRxiv - Molecular Biology 2022Quote: The Dux promoter was amplified by PCR with PCR mix (Yeasen, 10149ES03) and then cloned into pGL4.10[luc2] (Addgene, E6651) vector ...
-
bioRxiv - Microbiology 2022Quote: ... PCR fragments amplified from pFLAG-attP (Addgene, #110095) with primers Apr fw/Apr rv and from pSEVA524 with primers tetA fw/tetA rv,25 respectively ...
-
bioRxiv - Genetics 2022Quote: ... The TDH3 promoter was PCR-amplified from Addgene plasmid #67639 (a gift from John Wyrick) ...
-
bioRxiv - Genetics 2022Quote: ... We PCR amplified the NatMX cassette from Addgene plasmid #35121 using primers with homology to the 5’ upstream and 3’ downstream sequences of the targeted gene ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR product and pCS2-FLAG (AddGene 16331) were digested with EcoRI and XhoI and ligated with T4 DNA Ligase ...
-
bioRxiv - Cell Biology 2022Quote: ... A PCR product of ColX (from Addgene #110726) and a synthetic gene containing PAUF (Integrated DNA Technologies ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR products were cloned into pRAV23 (Addgene) using EcoRI and HindIII restriction sites and transformed into Top10 cells ...
-
bioRxiv - Cell Biology 2020Quote: ... a PCR product of myc-BirA* (35700; Addgene) was ligated into XhoI and SpeI cleaved pCAG-mNCad-HA ...
-
bioRxiv - Microbiology 2022Quote: ... which was PCR-amplified from pSFGFP-N1 (Addgene) [55].
-
bioRxiv - Cell Biology 2022Quote: ... The iRFP ORF was PCR amplified from Addgene plasmid #45457.
-
bioRxiv - Cancer Biology 2023Quote: ... HOXB13 was PCR amplified from pLX302_HOXB13 (Addgene #70089), digested with SalI/XbaI and ligated into linearized pENTR1A (Addgene #17398) ...
-
bioRxiv - Neuroscience 2023Quote: ... Gamillus obtained by PCR reaction from (Addgene #124837) was inserted in place of SEP with a use of NEBuilder HiFi DNA Assembly ...
-
bioRxiv - Developmental Biology 2024Quote: ... was PCR amplified from pJW2171 (Addgene plasmid #163095) and concentrated using a PCR purification kit (Qiagen) ...
-
bioRxiv - Genomics 2020Quote: ... and a revers primer (5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-GTGTCTCAAGATCTAGTTACGCCAAGC-3′) were used to amplify 222 bp fragments from CROPseq-Guide-Puro plasmids (#86708, Addgene) which have been inserted with different gRNA sequences ...
-
bioRxiv - Genomics 2019Quote: ... PCR products corresponding to each crRNA were amplified with U6 forward primer and corresponding antisense oligos (as listed in Supplemental Table S1) from the pX330 plasmid (Cat. 42230, Addgene). After digestion with DpnI (Cat ...
-
bioRxiv - Molecular Biology 2019Quote: ... gRNAs were obtained by annealing and cloning complementary primers into vector pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A) containing humanized S.pyogenes Cas9n(D10A) nickase (Addgene, cat. # 42335). Primers were designed to target the exon 2 of C6orf203 gene using E-CRISP double nickase platform (http://www.e-crisp.org/E-CRISP/ ...
-
bioRxiv - Bioengineering 2019Quote: ... and a 677-bp p10 3’ untranslated region (UTR) amplified with primers 984.4A and 984.4B from vector pJFRC81-10XUAS-IVS-Syn21-GFP-p10 (Addgene plasmid #36432). The anti-DENV scFv was then subcloned into the final vector from a gene-synthesized plasmid (GenScript ...
-
bioRxiv - Bioengineering 2021Quote: ... the U6.3-gRNATraB fragment was PCR amplified from the sgRNATra-B plasmid using primers 2XgRNA-5F and 2XgRNA-6R and was cloned into the sgRNAβTub plasmid (Addgene #112691). To build the TI-pgSITsxl,βTub,Hsp-Cas9 and TI-pgSITTraB,βTub,Hsp-Cas9 constructs (Supplementary Fig ...
-
bioRxiv - Neuroscience 2020Quote: ... which was cloned using forward 5’TTGACTGGCGTCATTCGGGA3’ and reverse 5’TCAGGAAGATCTGGGCAAAGAG3’ primers and expressed through the pInducer20 lentiviral vector (Addgene). Western blots were performed using actin as loading control ...
-
bioRxiv - Molecular Biology 2022Quote: ... dsDNA repair templates were amplified using primers with 5’ SP9 modifications (IDT) from the pJRK86 plasmid (AID*::GFP, Addgene #173743) and mIAA7 repair template plasmids in table 1 ...