Labshake search
Citations for Addgene :
401 - 450 of 1005 citations for rno mir 32 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... secA5-YFP sequences were amplified by PCR from pBH-UAS-secA5-YFP (Addgene), and subcloned into the pAAV-CAG-GFP (Addgene ...
-
bioRxiv - Physiology 2021Quote: ... Fluorescent protein sequences were PCR-derived from pmVenus(L68V)-mTurquiose2 (Addgene plasmid #60493), Gamillus/pcDNA3 (Addgene plasmid #124837) ...
-
bioRxiv - Biochemistry 2020Quote: ... The EMCV IRES sequence was amplified by PCR from EMCV_IRES_pcDNA4TO_H2B_SunTag24×_v1 (Addgene #246719) using the following primers ...
-
bioRxiv - Cancer Biology 2021Quote: Scarlet-H2A was amplified using PCR (donor plasmid: Addgene #85051, from Dorus Gadella) and subcloned into pDONR221 using the Gateway BP Clonase II enzyme mix (#11789020 ...
-
bioRxiv - Neuroscience 2021Quote: ... the fragments were amplified with PCR and then assembled in pHD-DsRed (RRID:Addgene_51434) with NEBuilder (New England BioLabs) ...
-
bioRxiv - Developmental Biology 2020Quote: ... human MEG3 cDNA was PCR amplified from the pCI-Meg3 (Addgene Plasmid #44727) using NEB Q5 high-fidelity polymerase ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the ~350 bp PCR product was cloned directionally into pFRB-NLUC (Addgene) cut with the BamH1 and BsiW ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The nourseothricin resistance gene (NAT) was PCR-amplified from pICH47732:FCP:NAT (Addgene #85984) using primers 1 and 2 (Table S5) ...
-
bioRxiv - Neuroscience 2022Quote: ... a GFP-kanamycin marker was PCR amplified from a template vector (PL452, Addgene). The primers include homology arms consisting of 50 nucleotides upstream and downstream from the start codon of the vav gene ...
-
bioRxiv - Cancer Biology 2023Quote: ... Myristolated AKT was amplified by PCR from pT3-myr-AKT-HA (Addgene #31789) and cloned into the pSBbi-w/o-Puro backbone ...
-
bioRxiv - Cell Biology 2023Quote: ... BirA was PCR amplified from pDisplay-BirA-ER (Alice Ting lab, Addgene #20856) with AttB sites as described above and transferred to pDEST12.2 or pLenti-DEST-EF1A-Hygro ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 pmol of PCR repair template amplified from pSNAP-tag plasmid (Addgene #101135) or mTagBFP2 plasmid (Addgene #75029 ...
-
bioRxiv - Biophysics 2022Quote: ... plasmids vector was obtained from circular PCR amplification of pBLO62.5 (Addgene plasmid #123124) with two primers respectively pairing to N-terminal and C-terminal NLS sequence (Tsuchida et al. ...
-
bioRxiv - Systems Biology 2023Quote: ... CSE1L and NUP37 were cloned by PCR into pEN_TT_miRc2 3xFLAG-BirA* (Addgene #192307). Full cloning details are available in Supplementary Data 7 ...
-
bioRxiv - Cell Biology 2023Quote: ... the RhoA biosensor fragment was PCR amplified from the pLentiRhoA2G plasmid (Addgene #40179) to add BamHI and XhoI sites at the ends ...
-
bioRxiv - Synthetic Biology 2023Quote: ... inverse PCR from CMVp-dsRed2-Triplex-28-gRNA1-28 (Addgene cat no. 55200) using a pair of primers including SacI restriction sites generated a linear plasmid ...
-
bioRxiv - Cancer Biology 2023Quote: ... were amplified by PCR and cloned into pLenti-GFP-puro (Addgene plasmids #17481) Lentivirus were produced by transforming pLenti constructs ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The first fragment was PCR amplified from pETM6-HCAmp-EV (Addgene Cat#49795)(P ...
-
bioRxiv - Bioengineering 2023Quote: ... difficle genome by PCR and cloned into the 2Bc-T plasmid (Addgene #37236); Nluc ...
-
A modular circuit architecture coordinates the diversification of courtship strategies in DrosophilabioRxiv - Neuroscience 2023Quote: ... and the p10-3’UTR PCR amplified from the plasmid pJFRC81 (Addgene #36432). These were then cloned by Gibson assembly (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... Templates for sgRNA synthesis were generated by PCR from a pX330 template (Addgene), sgRNAs were transcribed in vitro and purified (Megashortscript ...
-
bioRxiv - Neuroscience 2024Quote: ... and ii) PCR fragment of FLPo originated from pTCAV-FLEx-FLPo (#67829, Addgene). Because a nuclear localization signal (NLS ...
-
bioRxiv - Molecular Biology 2024Quote: ... the coding sequences of FLPo were PCR-amplified from pQUAST-FLPo (#24357, Addgene) and ligated into the XhoI-digested pUASz1.0 vector [45] using In-Fusion ...
-
bioRxiv - Cell Biology 2020Quote: ... Other gene deletions were generated using PCR products derived from pFA6a-kanMX6 (Addgene 39296) or pFA6a-hphNT1 (Euroscarf P30347 ...
-
bioRxiv - Cell Biology 2020Quote: mCherry-ER fusion protein was amplified by PCR from mCherry-ER-3 plasmid (Addgene) and cloned into Gateway modified pBABE (in house) ...
-
bioRxiv - Molecular Biology 2021Quote: ... emiRFP2 were PCR amplified and swapped with miRFP670nano in pKeratin-miRFP670nano plasmid (Addgene #127437) using Fusion cloning (Takara) ...
-
bioRxiv - Molecular Biology 2020Quote: ... crRNA linked with TRACR (sgRNA) were amplified by PCR with a pLKO vector (Addgene_52628) as template ...
-
bioRxiv - Genetics 2020Quote: ... Gal4 5’ and 3’ homology arms were PCR-amplified using pDEST-APIGH (Addgene # 112804) as the template ...
-
bioRxiv - Cancer Biology 2019Quote: ... by PCR and subcloning the product into the pENTR1A-GFP-N2 vector (Addgene # 9364) at the HindIII and BamH1 restriction sites ...
-
bioRxiv - Bioengineering 2021Quote: ... were PCR amplified from PmCDA1-1x uracil-DNA glycosylase inhibitor protein (UGI) (Addgene #79620), evoCDA1 pBT277 (Addgene #122608) ...
-
bioRxiv - Plant Biology 2021Quote: ... Gel-purified PCR product and SspI-digested pET-His6-MBP-TEV-LIC vector (Addgene) were treated with T4 DNA polymerase with 25 mM dCTP and dGTP for 30 min at 22°C followed by heat inactivation ...
-
bioRxiv - Cancer Biology 2020Quote: ... The PCR product was subcloned into pJFRC19-13XLexAOP-IVS-myr::GFP vector (Addgene#26224) to generate pJFRC19-13XLexAOP-yki3S/A ...
-
bioRxiv - Genetics 2022Quote: ... mouse cGAS was amplified via PCR from a pMSCVpuro-eGFP-cGAS template (Addgene, 108675) using primers containing KpnI and NotI restriction sites (S1 Table) ...
-
bioRxiv - Microbiology 2020Quote: ... dTomato gene was amplified by PCR from pLenti-V6.3 Ultra-Chili (Addgene plasmid # 106173) using primers dTomato_F_EEV and dTomato_linker_R_BH ...
-
bioRxiv - Molecular Biology 2021Quote: ... iRFP720 was obtained by PCR from iRFP720-N1 (gift from Vladislav Verkhusha, Addgene #45461).
-
bioRxiv - Neuroscience 2021Quote: ... TVA-mCherry was amplified by PCR from a plasmid (gift from Dr. Uchida, Addgene plasmid #38044 ...
-
bioRxiv - Cell Biology 2022Quote: ... Enhanced GFP (EGFP) was PCR cloned from pLenti CMV GFP Puro (Addgene 658-5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8-pCHD at the SalI and BamHI restriction sites.
-
bioRxiv - Cell Biology 2022Quote: ... Strep-KDEL was PCR amplified from Strep-KDEL-SBP-mCherry-GPI (Addgene plasmid #65295) and assembled to a BamHI/PsrI digested TtTMPV-Neo viral backbone (Addgene plasmid #27993) ...
-
bioRxiv - Genomics 2019Quote: ... The dLbuCas13 gene was amplified by PCR from the Lbu_C2c2_R472A_H477A_R1048A_ H1053A plasmid (Addgene #83485). The ADAR1DD (hyperactive E1008Q variant ...
-
bioRxiv - Genetics 2020Quote: ... The U6:3 promoter was PCR amplified from pAC-U63-tgRNA-Rev (Addgene #112811). The CR7T promoter was synthesized as a gBlock DNA fragment (IDT ...
-
bioRxiv - Cell Biology 2019Quote: ... and TIR1 sequence were amplified by PCR from pcDNA5-EGFP-AID-BubR1 (Addgene #47330) and pBABE TIR1-9Myc (Addgene #47328)30 plasmids ...
-
bioRxiv - Neuroscience 2020Quote: ... sequences were amplified by overlap PCR and subcloned into the AAV-CAG-GFP (Addgene) at BamHI and EcoRI ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The LOV2 domain was PCR amplified from the vector CMV-CASANOVA (Addgene plasmid #113035) previously reported by us (29) ...
-
bioRxiv - Cancer Biology 2019Quote: ... the KRAB domain was PCR amplified using pHR-SFFV-dCas9-BFP-KRAB (Addgene #46911) as a template ...
-
Epigenetic Interaction between UTX and DNMT1 Regulates Diet-Induced Myogenic Remodeling in Brown FatbioRxiv - Physiology 2020Quote: ... and 1039–1176) were PCR-amplified using the full-length Prdm16 plasmids (Addgene #15503) and sub-cloned into XbaI/EcoRI sites of Flag-HA-pcDNA3.1 vector (Addgene #52535) ...
-
ER exit sites in Drosophila display abundant ER-Golgi vesicles and pearled tubes but no megacarriersbioRxiv - Cell Biology 2021Quote: ... the APEX sequence was PCR-amplified from plasmid pcDNA3 APEX2-NES (Addgene, cat # 49386) with primers attNheIAPEX-F and attSpeIAPEX-R adding att sites ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR amplified ScTop2 and HsTOP2α cDNAs were inserted into the 12URA-B (Addgene #48304) yeast expression vector while HsTOP2β was inserted into the 12URA-C (Addgene #48305 ...
-
bioRxiv - Cell Biology 2022Quote: ... OMP25 was PCR amplified from paGFP-Omp25 (gift from D. Sabatini, Addgene plasmid #69598) and cloned with XhoI/BamHI into mMaple-C1 ...
-
bioRxiv - Cell Biology 2022Quote: ... RA was PCR amplified from RA-NES (gift from R. Campbell, Addgene plasmid #61019) (Ding et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... GB was PCR amplified from GB-NES (gift from R. Campbell, Addgene plasmid #61017) (Ding et al. ...