Labshake search
Citations for Addgene :
1901 - 1950 of 3495 citations for 6 9 Ethano 4H imidazo 4 5 d pyridazino 1 2 a pyridazin 4 one 2 butyl 3 6 7 8 9 11 hexahydro 6 9 dimethyl 3 2' 2H tetrazol 5 yl 1 1' biphenyl 4 yl methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: The pLKO.1-Puro plasmid was purchased from Addgene. Small hairpin RNAs were cloned for generation of knockdown constructs (shRNAs ...
-
bioRxiv - Neuroscience 2023Quote: We used the pLKO.1 vector (Addgene plasmid 10878)7 for expression of shRNA against rat Sirt3 (target ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV5-CAG- Dlight1.1 (n = 1 Area X hemisphere; Addgene). During the same surgery ...
-
bioRxiv - Neuroscience 2022Quote: AAV2/1 hsyn-jGCaMP8m-WPRE (Addgene, 2.0E13 GC/ml)
-
bioRxiv - Neuroscience 2022Quote: AAV2/1 hSyn-SF-iGluSnFR.A1848 (Addgene, 3E12 GC/ml)
-
bioRxiv - Neuroscience 2022Quote: AAV2/1 hsyn-jGCaMP8s-WPRE (Addgene, 2.8E13 GC/ml)
-
bioRxiv - Neuroscience 2022Quote: ... or 1 μl pENN.AAV.CamKII0.4.eGFP.WPRE.rBG (Addgene, catalog #105541-AAV9) bilaterally into the dorsal hippocampus (injection rate ...
-
bioRxiv - Microbiology 2022Quote: ... the pLKO.1-TRC cloning vector (Addgene plasmid 10879) was digested with EcoRI and AgeI to release a 1.9kb stuffer ...
-
bioRxiv - Cell Biology 2022Quote: ... melanogaster KHC residues 1-559 (adapted from Addgene #129761), the Kin2 construct consists of the M ...
-
bioRxiv - Immunology 2023Quote: ... A scramble shRNA-expressing pLKO.1 (Addgene Plasmid #1864) was used as control (shScr) ...
-
bioRxiv - Cancer Biology 2023Quote: ... shFF was cloned into pLKO.1-puro (Addgene #8453). For tet-inducible shRNA knock-down system ...
-
bioRxiv - Cancer Biology 2023Quote: shRNA against β-catenin was purchased from Addgene (pLKO.1 puro shβ-catenin; Addgene cat no.18803). shRNA targeting RelA and SP1 were cloned into pLKO.1-Puro vector individually according to Addgene’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV2/1-CAG-FLEX-EGFP-WPRE (Addgene, 51502). The final injection coordinates for caudolateral PAG were ...
-
bioRxiv - Cancer Biology 2023Quote: ... The plasmid pLKO.1 GFP shRNA (Addgene, #30323, RRID:Addgene_30323) was a gift from David Sabatini (110).The targeting sequences are described in Supplemental Table S1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The plasmid pLKO.1 GFP shRNA (Addgene, #30323, RRID:Addgene_30323) was a gift from David Sabatini (110).The targeting sequences are described in Supplemental Table S1 ...
-
bioRxiv - Systems Biology 2024Quote: ... or rabbit α-β-tubulin (Addgene ab6046, 1:10,000) as primary and HRP-α-Mouse (Cell Signaling ...
-
bioRxiv - Cancer Biology 2024Quote: ... shp53 pLKO.1 puro was purchased from Addgene (19119) (shp53 pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 19119 ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV5-hsyn-DIO-EGFP (Addgene, Catalog# 50457-AAV 1); pAAV5-FLEX-tdTomato (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... we utilized the pAAV2/1 packaging plasmid (Addgene #112862), diverging from our previous use of the pAAV 2/8 or 2/9 plasmids ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV5-hsyn-DIO-EGFP (Addgene, Catalog# 50457-AAV 1), pAAV5-FLEX-tdTomato (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: Galectin-3 cDNA was subcloned into the pMIG-GFP retroviral expression vector (plasmid #9044, AddGene, Cambridge, MA). Stably transduced hGalectin-3 expressing OP9 cells were generated by infecting cells with retroviral particles and FACS sorting of GFP expressing (positively transduced ...
-
bioRxiv - Molecular Biology 2021Quote: ... pYM-N2339 and pFA6a-hphMX-(3×FLAG)-TEV-ProtA (gift from Michael Nick Boddy, Addgene plasmid # 52692).
-
bioRxiv - Molecular Biology 2020Quote: ... mEmerald-ER-3 was a gift from Michael Davidson (Addgene plasmid # 54082; http://n2t.net/addgene:54082; RRID:Addgene_54082). Cells were seeded on high precision coverslips (Marienfeld ...
-
bioRxiv - Neuroscience 2019Quote: ... oligonucleotide pairs (Supplementary Table 3) were annealed and cloned into BbsI-digested pCFD3-dU6-3gRNA (Addgene #49410), as described59 ...
-
bioRxiv - Cell Biology 2021Quote: ... GST Tat was generated by cloning pNL4-3 derived tat gene in pGEX-4T1 vector from Addgene. HA Tat and Flag NQO1 were purchased from Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... 25 ng/µl of co-injection marker pCFJ104 (Pmyo-3:mCherry:unc-54 3’UTR, a gift from Erik Jorgensen, Addgene plasmid #19328; http://n2t.net/addgene:19328; RRID:Addgene_19328); 100 ng/µl of a construct expressing Cas9 and a sgRNA targeting the sequence ACATGAGTCTGTGTTTACGG (derived from pDD162 ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 × 106 HEK293T cells were transfected using GenJet transfection reagent (Signagen) with 7.5 µg psPax2 (Addgene #12260), 5 µg VSV-G (pMD2.G ...
-
bioRxiv - Neuroscience 2020Quote: A Nectin-3 overexpression construct was created by modifying a pCag-iCre expression vector (Addgene plasmid # 89573). Nectin-3 alpha was PCR amplified (KOD hot start DNA polymerase ...
-
bioRxiv - Molecular Biology 2019Quote: ... table 3 for sgRNA sequences) together with an expression vector encoding Cas9-2A-GFP (pX458; Addgene #48138) using lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2019Quote: ... and 3’UTR sequence of histone H1 sequentially into the backbone vector pFGL822 (Addgene #58225, Basta resistance); pCytoplasm GFP was constructed by inserting PCR fragments of histone H3 promoter and the GFP ORF sequentially into the backbone vector pFGL1010 (Addgene #119081 ...
-
bioRxiv - Immunology 2021Quote: ... HEK 293T cells were reverse-transfected with 3 plasmids: psPAX2 (a gift from Didier Trono, Addgene #12260), pEGFP-Vpr (obtained through the NIH HIV Reagent Program ...
-
bioRxiv - Microbiology 2022Quote: ... RSAD2 forward 5’ caccgAGTGGTAATTGACGCTGGTG 3’ and reverse 5’ aaacCACCAGCGTCAATTACCACTc 3’) were designed using CHOPCHOP web tool (https://chopchop.cbu.uib.no/) and cloned into pLentiCRISPR v2 vector (Addgene) as described [92 ...
-
bioRxiv - Neuroscience 2023Quote: Cortical neurons control and VPS50 mKO were co-infected at 3 DIV with GCaMP7f (Addgene Cat#104488). At 10 DIV ...
-
bioRxiv - Genomics 2023Quote: ... vectors were co-transfected with 3 µg of pCas9_GFP (a gift from Kiran Musunuru; Addgene plasmid #44719; http://n2t.net/addgene:44719; RRID:Addgene_44719) (Ding et al ...
-
bioRxiv - Genetics 2023Quote: ... pCFD4-U6:1_U6:3 was a gift from Simon Bullock (Addgene plasmid #49411; http://n2t.net/addgene:49411; RRID:Addgene_49411). His3.3A reference sequence ...
-
bioRxiv - Neuroscience 2023Quote: ... or a control virus (AAV2-hSyn-DIO-EGFP, 100 µL at titer ≥ 3×10¹² vg/mL, Addgene). A subset of the optogenetic L6-CT experiments was done in Ntsr1-Cre-ChR2-EYFP mice ...
-
bioRxiv - Neuroscience 2023Quote: ... Virus expressing gCaMP7f (AAV1-syn-jGCaMP7f-WPRE, stock concentration 3 x 1013 vg/mL, Addgene, 104488-AAV1)53 ...
-
bioRxiv - Microbiology 2024Quote: The full-length HIV vectors NL4-3 ΔEnv EGFP (HIV Reagent Program) and HIVGKO (Addgene plasmid #112234) were produced in HEK293T cells along with the VSV-G (Addgene plasmid # 8454 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 µg psPAX2 (psPAX2 was a gift from Didier Trono; Addgene plasmid # 12260) and 2 µg VSVg were mixed with 30 µL X-tremeGene9 transfection reagent (Sigma-Aldrich ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The module 5 was taken from the pAJM.847 plasmid in (41) (Addgene #108524 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a WPRE (cloned from pLenti CMV GFP Puro (658-5) (Addgene #17448)) all flanked by epigenetic insulator sequences by repetitive restriction digests (KflI-EcoRI ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 μg pMDLg/RRE and 2.5 μg pRSV-REV (Addgene #14888, #12251, #12253) using calcium phosphate ...
-
bioRxiv - Cell Biology 2022Quote: ... The hCRISPRi-v2 compact library (5 sgRNAs per gene, Addgene pooled library #83969) was transduced in duplicate into 330 million K562-CRISPRi-Tet-ON-((MICU1)-GFP1-10)-(tet-RFP-P2A-OMP25-GFP11 ...
-
bioRxiv - Cell Biology 2023Quote: ... 5*10^10 genomic copies of commercially produced AAV8-TBG-Cre (Addgene #107787) or control AAV8-TBG-GFP (Addgene #105535 ...
-
bioRxiv - Molecular Biology 2023Quote: ... to remove the neomycin selection cassette or both 5 μg pFlpO (Addgene #13792) and 5 µg of pCrePac(Taniguchi ...
-
bioRxiv - Neuroscience 2023Quote: The following viruses were used: AAV2/5-ef1alpha-FLEX-taCasp3-TEVp (Addgene, 45580) and AAV2/1-CAG-FLEX-EGFP-WPRE (Addgene ...
-
bioRxiv - Biochemistry 2023Quote: Guide RNA targeting PARP1 (5’- CCACCTCAACGTCAGGGTGC) was cloned into LentiCRISPRv2 vector (Addgene, 52961). Lentivirus carrying CRISPR/Cas9-PARP1 guide was transduced to HCT116 in the presence of 8 μg/ml polybrene ...
-
bioRxiv - Biochemistry 2023Quote: Guide RNA targeting ATP6V1B2 (5’- AAACTTACCATCATTAGGCA) was cloned into pX330 vector (Addgene, #42230). HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tacatgtatacagatttagccacgatatatgaacgcgctgggcgagtggaagggagaaacggctcgattactcaaatccctattctGacAatgcctaatA atggtaagttttggtatttggattataacacacctaatcattttaaagagagagaagacccatctaccttttcgagttgaagttattttgagaacacatc using TransIT-LT (Mirus) ...
-
bioRxiv - Biochemistry 2023Quote: Guide RNA targeting PARP1 (5’- AAACATGTAGCCTGTCTGGA) was cloned into pX330 vector (Addgene, #42230). HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccagacaggctacatgtttggtaaagggatcta tttcactgatatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatcctgttgggagaagttgcccttggaaacatgtg agt for A898T mutation and 5’- tggcactcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccag acaggctacatgtttggtaaaggaatctgtttcgctgacatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatc ctgttgggagaagttgcccttggaaacat for Y896C mutation using TransIT-LT (Mirus) ...
-
bioRxiv - Neuroscience 2023Quote: ... mice were injected with 0.5 µl of AAV2/5-CaMKIIα-GCaMP6f (Addgene, #100834) into the vH (AP -3.28 mm ...