Labshake search
Citations for Addgene :
2001 - 2050 of 3495 citations for 6 9 Ethano 4H imidazo 4 5 d pyridazino 1 2 a pyridazin 4 one 2 butyl 3 6 7 8 9 11 hexahydro 6 9 dimethyl 3 2' 2H tetrazol 5 yl 1 1' biphenyl 4 yl methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: pLKO.1-puro (Addgene #52628, a gift from Scot Wolfe) and the modified pLKO.1-puro/GFP vector system described in (Phelan et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... in the level 1 vector pICH47802 (Addgene, catalog number: 48007). Level 1 pICH47811-pTCSn::nls:tGFP::tATPase (position 2 ...
-
bioRxiv - Plant Biology 2021Quote: ... in the level 1 vector pICH47811 (Addgene, catalog number: 48008). To amplify IPT3 promoter (gene ID v4 ...
-
bioRxiv - Microbiology 2020Quote: ... pLKO.1-puro-shNT (gift from Jacob Corn, Addgene #109012) was used as a scrambled shRNA control ...
-
bioRxiv - Cell Biology 2021Quote: ... and AdEasier-1 cells (gift from Bert Vogelstein; Addgene, #16399)
-
bioRxiv - Neuroscience 2021Quote: ... Animals were injected with saline-diluted AAV2/1.hSyn.GCaMP6f.WPRE.SV40 (Addgene) at a depth of 250 and 550 µm (final concentration ...
-
bioRxiv - Cancer Biology 2019Quote: ... followed by pLenti-CMV-Puro DEST vector (Addgene, w118-1). The plasmids were propagated in DH5α bacterial cells (Life Technologies) ...
-
bioRxiv - Biophysics 2019Quote: ... human α-actinin 1 cDNA (Addgene; pEGFP-N1 alpha-actin1) was truncated at the actin binding domain (Asp1-Ala247) ...
-
bioRxiv - Cancer Biology 2020Quote: ... pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 8453 ...
-
bioRxiv - Neuroscience 2019Quote: ... and β-arrestin 1-FLAG (#14687) were obtained from Addgene.
-
bioRxiv - Cancer Biology 2019Quote: ... expressed from a pLKO.1-hygro plasmid backbone (Addgene #24150). Three days after lentiviral transduction ...
-
bioRxiv - Cell Biology 2020Quote: ... pLKO.1 constructs were co-transfected with psPAX2 (Addgene 12260) and VsvG (Addgene 8454 ...
-
bioRxiv - Biochemistry 2021Quote: ... Nb_EfrCD#1 was cloned into expression plasmid pBXNPHM3 (Addgene #110099) using FX cloning and expressed as described previously [42] ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV.1.hSyn.dio.EGFP (anterograde labelling, 140 nl, Addgene, no. 50457); retrograde.AAV.hSyn1.chI.mCherry.2A.iCre.WPRE.SV40p (retrograde labelling of LHb inputs and whole-brain clearing ...
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5.0 × 1012 GC/ml (Cat # AV-1-ALL854, RRID:Addgene_51502 ...
-
bioRxiv - Neuroscience 2022Quote: AAV2/1 hSyn-DIO-stGtACR2-FusionRed (Addgene, 4.2E13 GC/ml)
-
bioRxiv - Neuroscience 2022Quote: ... to inject 1 μl pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 (Addgene, catalog # 105551-AAV9) or 1 μl pENN.AAV.CamKII0.4.eGFP.WPRE.rBG (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... The following AAVs were injected: 1) AAV1.hSyn.cre.WPRE.hGh (Addgene #105553) at one of three doses (1.73×1012 ...
-
bioRxiv - Immunology 2022Quote: ... et al 16 were purchased from Addgene (Supplemental Table 1), and used to make stable expression cell lines in HEK293 cells by lentiviral transduction ...
-
bioRxiv - Neuroscience 2022Quote: ... Viral injections of 1 μl hSyn.iGluSnFr.WPRE.SV40 (Addgene, plasmid #98929-AAV1) for glutamate imaging or 1 μl pENN.AAV.CamKII.GCaMP6f.WPRE (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... the IMS using SMAC (residues 1-59, from Addgene 136469), the IBM using IMMT (residues 1-18734) ...
-
bioRxiv - Molecular Biology 2023Quote: ... in the Level 1 acceptor plasmids pL1P3-TaU6 (Addgene #165599) and pL1P4-TaU6 (Addgene #165600) ...
-
bioRxiv - Biochemistry 2023Quote: ... was mixed with packaging plasmids MD2G (1 μg, Addgene 12,259) and PSPAX2 (1 μg ...
-
bioRxiv - Developmental Biology 2023Quote: ... pBS-KS-attB2-SA(1)-T2A-GAL4DBD-Hsp70 (Addgene #62903), pBS-KS-attB2-SA(2)-T2A-GAL4DBD-Hsp70 (Addgene #62904) ...
-
bioRxiv - Developmental Biology 2023Quote: ... pBS-KS-attB2-SA(1)-T2A-VP16AD-Hsp70 (Addgene #62908), and pBS-KS-attB2-SA(2)-T2A-p65AD-Hsp70 (Addgene #62915) ...
-
bioRxiv - Neuroscience 2023Quote: ... DJ-1 (a gift from Mark Cookson, Addgene plasmid 29347), synapto-iATPSnFR2-miRFP670nano3 ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAVrg.Syn.jGCaMP7b.WPRE (Addgene, lot. no. v63074, titer 1 x 1013). For GCaMP expression in the DRG neurons ...
-
bioRxiv - Microbiology 2023Quote: pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 8453 ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV9-CaMKIIa-EGFP (titer: 1×10¹³ vg/mL, Addgene) for chemogenetic silencing and viral control ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-Syn-GCaMP6m-RPL10a (1−1013 gc/mL; Addgene #158777) was injected into PM ...
-
bioRxiv - Neuroscience 2024Quote: ... and pAAV2/1 (a gift from James M. Wilson, Addgene plasmid #112862 ...
-
bioRxiv - Neuroscience 2024Quote: ... viral injections of AAV2/1-CAMK1a-gCaMP6f (Addgene #100834-AAV1) were made into the binocular zone ...
-
bioRxiv - Cancer Biology 2024Quote: shRNAs and were cloned into pLko.1-puro (Addgene #8453) linearized with AgeI and EcoRI ...
-
bioRxiv - Cancer Biology 2024Quote: ... or an empty backbone pLKO.1 control (Addgene plasmid #8453) were used to generate virus and infect OVCAR3 cells or ID8 cells ...
-
bioRxiv - Cancer Biology 2021Quote: ... we cloned Myc-FLAG tagged POT1 into T7 expression vector (pcDNA 5/FRT, Addgene) and performed site-directed mutagenesis ...
-
bioRxiv - Cancer Biology 2021Quote: mRFP-FKBP-5-ptase-dom and PM-FRB-CFP plasmids were obtained from Addgene (deposited by the laboratory of T ...
-
bioRxiv - Cell Biology 2020Quote: ... The cell line carrying the 5’TOP element-containing SunTag reporter (Addgene plasmid #119946) together with scFv-GFP and NLS-stdMCP-stdHalo was described previously (Wilbertz et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl cold lysisg/μl cold lysisl pCAGG>nls-hCas9-nls-GFP (Addgene #99141) and 3 μl cold lysisg/μl cold lysisl U6.3>Lhx5/Sox1/Six3 gRNA f+e was microinjected together with the Fast Green solution (Sigma ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the sequence of Francisella novicida cas12a was amplified from pUDC175 (Addgene plasmid #103019, (5)) using primers 13553-13554 ...
-
bioRxiv - Molecular Biology 2020Quote: The hCRIPSRi-v2 library top 5 sgRNAs/ gene (Horlbeck et al. 2016)(Addgene # 83969), was a gift from the Jonathan Weissman lab at UCSF ...
-
bioRxiv - Cell Biology 2022Quote: ... Enhanced GFP (EGFP) was PCR cloned from pLenti CMV GFP Puro (Addgene 658-5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8-pCHD at the SalI and BamHI restriction sites.
-
bioRxiv - Genomics 2023Quote: K562 CRISPRi cells were transduced with the hCRISPRi-v2 top 5 library (Addgene #83969)138 with 840X representation ...
-
bioRxiv - Cell Biology 2023Quote: ... The FUCCI adenoviral vector was generated by cloning tFucci(CA)5 (Addgene plasmid #153521) into the pShuttle-CMV vector ...
-
bioRxiv - Neuroscience 2023Quote: ... an inhibitory opsin (AAV1-hSyn-SIO-stGtACR2-FusionRed, 5 x 1011 vg/ml, Addgene) or a control virus (AAV2-hSyn-DIO-EGFP ...
-
bioRxiv - Neuroscience 2024Quote: AAV serotype 5 OTp-hM3Dq-Myc (2.9 × 1012 gp/mL) (Corresponding plasmid: Addgene #184753)84
-
bioRxiv - Cell Biology 2023Quote: ... 5 x 106 HEK293T cells were co-transfected with 5μg psPAX2 (Addgene, Plasmid # 12260), 5μg pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... libraries with 5 sgRNAs per gene (mCRISPRi-v2; the “top5” library from Addgene #1000000092) or 10 sgRNAs per gene (hCRISPRi-v2 ...
-
bioRxiv - Cell Biology 2020Quote: ... and pT7-7 α-Syn A53T (Addgene plasmid #10572737 ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmid mEGFP- lifeact-7 (Addgene # 54610) was a gift from Michael Davidson and Lamp1-mGFP (Addgene # 34831 ...
-
bioRxiv - Cell Biology 2021Quote: ... and mRuby-LifeAct-7 (Addgene plasmid #54560) were gifted by Michael Davidson ...