Labshake search
Citations for Addgene :
1751 - 1800 of 3495 citations for 6 9 Ethano 4H imidazo 4 5 d pyridazino 1 2 a pyridazin 4 one 2 butyl 3 6 7 8 9 11 hexahydro 6 9 dimethyl 3 2' 2H tetrazol 5 yl 1 1' biphenyl 4 yl methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... animals were injected with a target transgene (50 ng μl-1) with plasmid pJL43.1 (50 ng μl-1) (Addgene) that expresses MosTase under a germline promoter and plasmid pMR910 (20 ng μl-1 ...
-
bioRxiv - Cancer Biology 2024Quote: Viral particles were packaged in HEK293T cells by transfecting the pLKO.1-shCYB561 constructs or scrambled shRNA pLKO.1 (RRID:Addgene_1864) (30 ...
-
bioRxiv - Cell Biology 2022Quote: ... with AgeI and BstBI restriction sites into the pLenti CMV/TO GFP-MDC1 (779-2) (plasmid #26285, Addgene, gift from E. Campeau; Genewiz) backbone ...
-
bioRxiv - Cancer Biology 2019Quote: ... HEK293T cells were transfected with psPAX2 and pMDG.2 packaging plasmids (gifts from Didier Trono, EPFL, Lausanne, Switzerland; Addgene plasmids 12559 and 12660) and the lentiviral expression construct ...
-
bioRxiv - Cancer Biology 2020Quote: pBABE-SAOS 2 and hTERT-SAOS 2 stable cell lines were obtained upon transfection of the SAOS 2 cell line with the plasmids pBABE-puro or pBABE-puro-hTERT from Addgene (#1764, #1771, respectively), and Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids encoding the SARS-CoV-2 open reading frames proteins and eGFP control were a kind gift of Nevan Krogan (Addgene plasmid #141367-141395). Plasmids were acquired as bacterial LB–agar stabs ...
-
bioRxiv - Neuroscience 2022Quote: ... All cell lines presented in this study are available from the corresponding author upon request and all plasmids are available from Addgene (Supplementary Table 2).
-
bioRxiv - Cancer Biology 2020Quote: ... HEK293T cells were transfected with psPAX2 and pMDG.2 packaging plasmids (gifts from Didier Trono, EPFL, Lausanne, Switzerland; Addgene plasmids 12559 and 12660) and the lentiviral expression construct ...
-
bioRxiv - Microbiology 2022Quote: ... were cloned from pLVX- EF1alpha-SARS-CoV-2-M-2xStrep-IRES-Puro and pLVX-EF1alpha-SARS-CoV-2-E-2xStrep- IRES-Puro (kind gifts from Nevan Krogan, available from Addgene #141386 and #141385) using PCR to remove the 2xStrep epitope tag ...
-
bioRxiv - Cancer Biology 2021Quote: ... HEK293T cells were transfected with psPAX2 and pMDG.2 packaging plasmids (gifts from Didier Trono, EPFL, Lausanne, Switzerland; Addgene plasmids 12559 and 12660), the lentiviral expression plasmid ...
-
bioRxiv - Biophysics 2022Quote: The plasmid encoding GPCR kinase subtype 2 used for the receptor phosphorylation in insect cells (GRK2-CAAX) was a gift from Robert Lefkowitz (Addgene plasmid #166224 49). Full-length arrestin21-418 (C150L ...
-
bioRxiv - Cancer Biology 2022Quote: ... shNFATC2IP#2: ACATTTGCTTGAGGCTTATAC) were cloned into Tet-pLKO-puro or TET-pLKO-neo vectors (gifts from Dmitri Wiederschain, Addgene plasmids #21915 and #21916). Hairpins were introduced by lentiviral transduction using pRSV-Rev (Addgene plasmid # 12253) ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg Cas9 expression plasmid pSpCas9(BB)-2A-Puro (Addgene, PX459) was stably transfected into 8×105 DBA/2 ES cells via electroporation ...
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5 × 1012 GC/ml (Addgene viral prep # 18917-AAV1, RRID:Addgene_18917), and
-
bioRxiv - Biophysics 2022Quote: ... 5 μM Sfp synthase (plasmid obtained from Addgene (pET-Sfp, #159617) and purified as described (Yin et al ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV8-nEF-Con/ Fon-TVA-mCherry (Addgene 131779, 5×1012 titer) and AAV8-EF1α-Con/Fon-oG (Addgene 131778 ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV8-EF1α-Con/Fon-oG (Addgene 131778, 5×1012 titer) were mixed in equal proportions (final titer = 2.5×1012 each ...
-
bioRxiv - Cell Biology 2020Quote: ... The pSIN-3×flag-ATF3 vector was derived from pSin-EF2-Nanog-Pur (#16578, Addgene). HEK293T cells were seeded so that cells density could be 80% confluence when it comes to transiently transfection ...
-
bioRxiv - Neuroscience 2020Quote: ... with 3 µg of the episomal plasmid mix (equimolar mixture of plasmids obtained from Addgene: pCE-hOct3/4 ...
-
bioRxiv - Genetics 2019Quote: ... the scaffold DNA sequence was amplified from pDD162 (Peft-3::Cas9 + dpy-10 sgRNA - Addgene plasmid # 47549 ...
-
bioRxiv - Neuroscience 2023Quote: ... HEK293T cells were co-transfected with 3 plasmids: pAd-DELTA F6 (plasmid No. 112867; Addgene), serotype plasmid AAV PHP.eB ...
-
bioRxiv - Plant Biology 2023Quote: ... and 3′ UTR and terminator sequences from Agrobacterium tumefaciens nopaline synthase (AtuNOST) (pICH41421, Addgene #50339). As a batch calibrator ...
-
bioRxiv - Cancer Biology 2023Quote: ... The ITGB3 sequence (pcDNA3.1-beta-3 was a gift from Timothy Springer; Addgene plasmid # 27289) was subcloned into pLenti6.3/TO/V5-Blasti (A11144 ...
-
bioRxiv - Genetics 2023Quote: ... and 3’ extension oligos were cloned into the BsaI-digested pU6-pegRNA-GG- (Addgene #132777), pU6-tevopreQ1-GG- (Addgene #174038 ...
-
bioRxiv - Neuroscience 2023Quote: Unilateral stereotaxic injections of AAV5-CaMKIIα-EGFP (Addgene #50469; virus titer ≥ 3×10¹² vg/mL) and AAV5-hSyn-DIO-hM4D(Gi)-mCherry (Addgene #44362 ...
-
bioRxiv - Neuroscience 2023Quote: ... The amplicons were inserted into the pCMV-Tag-2b or pGEX-5X-3 vector (Addgene). Spastin mutants were generated using the Quickchange Kit (Agilent ...
-
bioRxiv - Cell Biology 2023Quote: ... Homology arms were cloned into pDD268 [11] (Addgene #132523) using NEBuilder Hifi DNA assembly Master Mix (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: The FL and 4H TLNRD1 were described previously (Cowell et al., 2021) and are available on Addgene (Addgene plasmids 159384 and 159386). The FL CCM2 constructs were purchased from GeneArt and subcloned into pET151 ...
-
bioRxiv - Cell Biology 2021Quote: ... and pLenti CMV rtTA3 Hygro (w785-1) used for creating tetracycline-inducible cell lines were gifts from Eric Campeau (w762-1: Addgene plasmid #26434 ...
-
bioRxiv - Genomics 2020Quote: ... Plasmids for human LINE-1 expression: pBS-L1PA1-CH-mneo (CMV-LINE-1) was a gift from Astrid Roy-Engel (Addgene plasmid # 51288 ...
-
bioRxiv - Cancer Biology 2021Quote: ... For loss of function studies, pLKO.1 puro and pLKO.1 shCDH1 (Onder et al., 2008) were purchased from Addgene. pLL3.7m-Clover-Geminin(1-110)-IRES-mKO2-Cdt(30-120 ...
-
bioRxiv - Cell Biology 2022Quote: ... gBlock 1 encoding N-terminus Calponin domains (CH-CH) of giant Nesprin 1 was cloned into Spectrin-cpstFRET (plasmid#61109, Addgene) cut with AgeI and ScaI renstriction enzymes (New England Biosciences) ...
-
bioRxiv - Cell Biology 2019Quote: ... The short isoform of human NEAT-1 lncRNA (hNEAT-1 v1) was amplified from the plasmid pCRII_TOPO_hNEAT1 (a gift from Archa Fox, Addgene plasmid 61518) and incorporated into an AgeI/BamHI digested pmax-ponA backbone vector ...
-
bioRxiv - Microbiology 2020Quote: ... pmTurquiose2-Golgi (Beta-1,4-galactosyltransferase 1 1-61 Aa) in red is to show the Golgi apparatus (Addgene cat 36205) (27) ...
-
bioRxiv - Physiology 2019Quote: ... annealed and cloned into pLKO.1 at EcoRI and AgeI restriction sites as per the pLKO.1 protocol from Addgene. The resultant plasmids were transformed in DH5α cells for amplification and isolated ...
-
bioRxiv - Immunology 2020Quote: ... and the full-length protein (IFT20, aa 1-132) in-frame with the tags into the pEGFP-N1 (#6085-1 Addgene) and pGEX-6P-2 vectors (#27-4598-01Addgene) ...
-
bioRxiv - Biophysics 2023Quote: ... The DNA fragment encoding the T-cell-restricted intracellular antigen-1 (TIA-1) was digested from pFRT-TO-eGFP-TIA1 (#106094, Addgene) using Bsp1407I (TaKaRa ...
-
bioRxiv - Neuroscience 2023Quote: ... we used a 1:1 combination of AAV8-CaMKIIα-GFP-Cre (UNC) and AAV2-hSyn-DIO-hM4D(Gi)-mCherry (Cat. #44362, Addgene).
-
bioRxiv - Evolutionary Biology 2024Quote: ... with 0.5 µg of either a 1:1 mixture of the S plasmids and a Jun-Nt Venus fragment (Addgene 22012) plasmid or a mixture of hACE2 plasmid (kindly provided by Dr ...
-
bioRxiv - Biochemistry 2024Quote: ... The Venus-PDZ1 (ZO-1) was generated by site directed mutagenesis of the Venus-ZO-1 expression vector (Addgene: 56394) using primer pairs that delete the entire ZO-1 coding sequence except for the first PDZ1 domain ...
-
bioRxiv - Neuroscience 2021Quote: ... The pLKO.1-TRC cloning vector (RRID: Addgene_10878) and the pLKO.1-sh-Ctl (RRID ...
-
bioRxiv - Neuroscience 2021Quote: ... and the pLKO.1-sh-Ctl (RRID: Addgene_10879) were kindly provided by Marian Martínez-Balbás ...
-
bioRxiv - Cell Biology 2021Quote: ... to either pLKO.1 puro (Addgene Plasmid #8453) for constitutive knockdown or Tet-pLKO-puro (Addgene Plasmid #21915 ...
-
bioRxiv - Genetics 2021Quote: ... and 1 μg CMV-SB10 (Addgene plasmid # 24551) via the tail vein in 5-7 s ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1 μg pCAGGS-mCherry (Addgene, plasmid #41583) (45) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Using 1 ng pCFD6 (Addgene, Cat. No: 73915) as template ...
-
bioRxiv - Biophysics 2019Quote: ... and human KIF1A (aa 1-393; Addgene # 61665). Tau-2N4R ...
-
bioRxiv - Neuroscience 2020Quote: ... and 1 μL of LSL-tdTomato (Addgene#: 100048); 2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and pLKO.1-shGFP control (Addgene, cat#30323) vectors were packaged using the ViraPower Kit (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... The plasmid pIRES2-eGFP (Addgene, Cat#6029-1) was used as transfection control ...