Labshake search
Citations for Addgene :
1701 - 1747 of 1747 citations for L β Homo β 2 hydroxyphenyl glycine; R 3 Amino 3 2 hydroxyphenyl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... of L-type Ca2+ channels was a gift from Diane Lipscombe (Addgene plasmid # 26572; http://n2t.net/addgene:26572; RRID:Addgene_26572). The mApple-myosin X was subcloned by the Protein Cloning and Expression Core facility of the MBI.
-
bioRxiv - Neuroscience 2021Quote: ... 52.11 mg, Addgene 59924; P, 30.15 mg, Addgene 59925; L, 23.70 mg, Addgene 59922; G, 20.26 mg, Addgene 59921). Cells were maintained with DMEM with GlutaMAX supplement ...
-
bioRxiv - Systems Biology 2022Quote: ... cassette from pKD4 (pKD4 was a gift from Barry L. Wanner (Addgene plasmid # 45605; http://n2t.net/addgene:45605; RRID:Addgene_45605), (Datsenko & Wanner ...
-
bioRxiv - Systems Biology 2022Quote: ... cassette from pKD3 (pKD3 was a gift from Barry L. Wanner (Addgene plasmid # 45604; http://n2t.net/addgene:45604; RRID:Addgene_45604)) ...
-
bioRxiv - Neuroscience 2021Quote: ... mice were microinjected 0.3 µl of AAV5-hsyn-NE2.1 (h-N01, WZ Biosciences) and 0.5 µl of AAV9-hsyn-jRGECO1a (100854, Addgene) to the left Cg1 (AP=2.2mm ...
-
bioRxiv - Developmental Biology 2021Quote: The Tg(fli1a:Brainbow1.0L)mu254 (flibow) transgenic fish was generated by cloning the CMV-Brainbow-1.0 L construct (Addgene #18721) downstream of the fli1a promoter62 ...
-
bioRxiv - Bioengineering 2024Quote: The Bclx(L) and Aven genes were cloned into a bi-cistronic pBUD-EFGP plasmid (Addgene Plasmid #23027). The Bclx(L ...
-
bioRxiv - Biochemistry 2024Quote: ... The sequence encoding NiV L was cloned into the 438-C vector (kind gift from Scott Gradia; Addgene plasmid # 55220 ...
-
bioRxiv - Cell Biology 2020Quote: ... was integrated in the U2OS genome using F-Talen and R-Talen (pZT-C13-R1 and pZT-C13-L1, Addgene:62196, 62197) targeting the human CLYBL intragenic safe harbor locus between exons 2 and 3 (as was described previously (Tian et al. ...
-
bioRxiv - Developmental Biology 2021Quote: The pU6-chiRNA:sgRNA plasmid was obtained by incorporating the sgRNA sequence (obtained by annealing phos-gRNA-F and phos-gRNA-R, Supplementary Table 1) into pU6- BbsI-chiRNA (Addgene plasmid # 45946) (22 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... with primers TRE_F &R and inserted into the EcoRV restriction site of AAVS1-Neo-M2rtTA (a gift from Dr Rudolf Jaenisch, Addgene plasmid # 60843)(DeKelver et al. ...
-
bioRxiv - Biophysics 2021Quote: ... ΔmutL strains were co-transformed with MutL/MutL(R-E) expression plasmid and pTARA plasmid (for T7 RNA polymerase expression, a gift from Kathleen Matthews, Addgene plasmid #31491)73 ...
-
bioRxiv - Microbiology 2020Quote: ... carries the marker mutation A1244G and was cloned from the tdTomato-pBAD plasmid (a kind gift from Drs. M. Davidon, N. Shaner, and R. Tsien, Addgene plasmid #54856). The humanised reporter gene Renilla luciferase (GenBank AF362549 ...
-
bioRxiv - Immunology 2024Quote: ... 2×106 HEK293T cells were transfected simultaneously with 20µg of a pNL4.3Balenv plasmid (provided by R. Pomerantz, Thomas Jefferson University, Philadelphia, PA) and 10 µg of a pMIG-155 plasmid (Addgene cat#26529). To produce HIV-1 particles along with mock EVs ...
-
bioRxiv - Cell Biology 2020Quote: ... The plasmid containing the α1C subunit (CaV1.2) of L-type Ca2+ channels was a gift from Diane Lipscombe (Addgene plasmid # 26572 ...
-
bioRxiv - Immunology 2022Quote: ... To subclone the fusion protein constructs GFPNKG2D-S/L into the retroviral stem cell vector pMIGR1 (Addgene, plasmid 27490), forward 5’ TAGTAGGAATTCGCCACCATGAGCGGGGGCGAGGAC 3’ and the reverse 5’ TAGAGGTCGACCTTACACCGCCCTTTTCATGCAG3’ primers were used ...
-
bioRxiv - Cancer Biology 2020Quote: ... L-Myc or LacZ open reading frame (ORF) was cloned into pLEX_307 (a gift from David Root, Addgene #41392) using the Gateway® cloning methods according to manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2024Quote: Following plasmids were used for transfection pN1-CMV-sDarken (Addgene plasmid #184799, pN1-CMV-L-sDarken (Addgene plasmid #184800), null-mutant of sDarken (created in house) ...
-
bioRxiv - Neuroscience 2022Quote: ... to enable downstream experiments with GFP based reporters together with this line) was amplified from pJFRC206 (with primers smGFP::v5_hifi_F/R from Addgene #63168, (Nern et al., 2015)) ...
-
bioRxiv - Cell Biology 2020Quote: ... and 75 ng/µl of a construct expressing a sgRNA targeting ACGGCTCATAAGAGACTTGG (derived from p46169, which was a gift from John Calarco, Addgene plasmid # 46169 ...
-
bioRxiv - Neuroscience 2022Quote: ... Rats received bilateral intra-accumbens infusions (1 μl/side) of a Cre-dependent adeno-associated viral vector (AAV) expressing eYFP (AAV5-EF1a-DIO-eYFP-WPRE-hGH; Addgene) or a Cre-dependent AAV expressing ChR2 with an eYFP tag (AAV5-EF1a-DIO-hChR2(H134R)-eYFP-WPRE-hGH ...
-
bioRxiv - Systems Biology 2022Quote: ... or in case of the aspC deletion the chloramphenicol (Cap) cassette from pKD3 (pKD3 was a gift from Barry L. Wanner (Addgene plasmid # 45604 ...
-
bioRxiv - Systems Biology 2022Quote: ... kanamycin resistance cassettes were generated via PCR – ‘KO’ primers with 50 bp homologous arms are listed in Supplementary Table S4 – using the kanamycin (Km) cassette from pKD4 (pKD4 was a gift from Barry L. Wanner (Addgene plasmid # 45605 ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.1 μL of adeno-associated virus serotype 9 (AAV9) carrying GCaMP6f under the excitatory neuronal promoter CaMKII (AAV-CaMKII-GCaMP6f) (Addgene) to co-transfect the TRPV1 and GCaMP6f into neurons.
-
bioRxiv - Cell Biology 2023Quote: ... they were electroporated with Yamanaka’s plasmids (plasmid numbers 27078 (human SOX2 and KLF4), 27080 (human L-MYC, LIN28), 27077 (human OCT3/4, shRNA against TP53) from Addgene, www.addgene.org ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 2.5ul PLUS reagent with 1000 ng of reporter donor plasmid and 500 ng of each TALEN-L (Addgene 35431) and TALEN-R (Addgene 35432 ...
-
bioRxiv - Genomics 2024Quote: ... 15 million HEK293T cells were transfected 15 million HEK293T cells were grown overnight on 15 cm poly-L-Lysine coated dishes and then transfected with 6 ug pMD2.G (Addgene plasmid # 12259 ...
-
bioRxiv - Developmental Biology 2024Quote: ... in 180 μL TiF2 medium were mixed with 20 μL RNP (50 pmol Cas9 and 250 pmol sgRNA) or 10 μg PB-CAG-eGFP and pCAG-PBase plasmids (Addgene) in 20 μL Opti-MEM and added into 4 mm gene pulser cuvettes (total volume 200 μL) ...
-
bioRxiv - Neuroscience 2021Quote: ... A fragment containing three repetitions of the retinoic acid response element (RARE) sequence followed by the weak promoter SV40 was sub-cloned from pGL3-RARE-luciferase (Addgene Plasmid #13458), a kind gift of the Underhill Lab64 ...
-
bioRxiv - Biophysics 2021Quote: ... The mEGFP-(L)_pcDNA3.1+ plasmid was obtained by amplifying mEGFP from an mEGFP-N1 vector (a gift from Michael Davidson, Addgene plasmid # 54767) (using a primer encoding a long rigid linker sequence ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The integration of the reporter was performed by co-transfecting 1000 ng TagRFP reporter (5xTetO-pEF-TagRFP-3xNLS) donor plasmid and 500 ng of each TALEN arm (AAVS1-TALEN-L (Addgene #35431) targeting TGTCCCCTCCACCCCACA and AAVS1-TALEN-R (Addgene #35432 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... into the AAVS1 locus by electroporation of K562 cells with 1000 ng of reporter donor plasmid and 500 ng of each TALEN-L (Addgene #35431) and TALEN-R (Addgene #35432 ...
-
bioRxiv - Molecular Biology 2024Quote: ... reporter cell lines were generated by TALEN-mediated homology-directed repair to integrate enhancer reporter donor constructs into the AAVS1 locus by electroporation of 1 × 106 K562 cells (or K562 cells selected to have the desired synthetic transcription factor) with 1 ng of reporter donor plasmid and 0.5 ng of each TALEN-L (Addgene no. 35431) and TALEN-R (Addgene no ...
-
bioRxiv - Systems Biology 2022Quote: ... into the AAVS1 locus by electroporation of K562 cells with 1000 ng of reporter donor plasmid and 500 ng of each TALEN-L (Addgene #35431) and TALEN-R (Addgene #35432 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Reporter DNA was integrated by TALEN-mediated homology-directed repair to integrate donor constructs into the AAVS1 locus by electroporation of 1 × 106 cells with 1 μg of reporter donor plasmid and 0.5 μg of each TALEN-L (Addgene no. 35431) and TALEN-R (Addgene no ...
-
bioRxiv - Biochemistry 2020Quote: ... without start codons and without their native signal peptides identified using SignalP 5.0 with the Gram-positive setting.35 Their open-reading frames were cloned into the expression vector p15TV-L (AddGene ID: 26093) under the T7 promoter and in-frame with the N-terminal 6xHisTag (Twist Bioscience) ...
-
bioRxiv - Biophysics 2021Quote: ... a mp-mEYFP-(L)-mCherry2-(L) construct was first cloned by amplifying mCherry2 from a mCherry2-C1 vector (a gift from Michael Davidson, Addgene plasmid # 54563) and inserting it into mp-mEYFP-(L)_pcDNA3.1+ by digestion with AflII and KpnI ...
-
bioRxiv - Biochemistry 2022Quote: ... The open-reading frames (codon-optimized for expression in E. coli) were cloned into the expression vector p15TV-L (AddGene ID: 26093) under the T7 promoter and in-frame with the N-terminal 6xHisTag (Twist Bioscience) ...
-
bioRxiv - Molecular Biology 2024Quote: We reconstituted RIF1-/- U-2 OS cells with full-length RIF1-L and RIF1-S coding sequences (CDS) cloned into a tetracycline-inducible pcDNA5-eGFP-FRT/TO plasmid vector (Addgene plasmid #19444) by Gateway recombination cloning (Invitrogen ...
-
bioRxiv - Plant Biology 2022Quote: ... For this the mNeonGreen coding sequence was amplified using primers mNG-HindIII-F and mNG-stop-EcoRI-R (Table S6) from pPY22 (Addgene plasmid #137082; Yi and Goshima, 2020), introducing a GSGGSG-encoding linker before mNeonGreen in the process) ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 μl of AAV5-Syn-GCaMP6f-WPRE-SV40 (titre 2.8 × 1013 GC/ml; gift from Douglas Kim & GENIE Project; Addgene viral preparation #100837-AAV5)62 was injected using a microinjection pump (Nanoliter 2010 ...
-
bioRxiv - Neuroscience 2021Quote: ... and SAD-B19 helper proteins (N, 52.11 mg, Addgene 59924; P, 30.15 mg, Addgene 59925; L, 23.70 mg, Addgene 59922; G, 20.26 mg, Addgene 59921). Cells were maintained with DMEM with GlutaMAX supplement ...
-
bioRxiv - Neuroscience 2023Quote: ... mice were stereotaxically injected under isoflurane anesthesia (1% v/v in oxygen, 1 L/min) with 250 nL of AAV8-hSyn-DIO-hM3d(Gq)-mCherry (Addgene, Catalog # 44361-AAV8) at a rate of 50 nL/min using a 1000 nL Hamilton syringe bilaterally in the dorsal striatum (coordinates ...
-
bioRxiv - Neuroscience 2021Quote: ... Synaptophysin1-mCherry plasmid was generated by replacing the pHluorin-tag in Synaptophysin1-pHluorin (gift from L. Lagnado, Addgene plasmid # 24478, (Granseth et al, 2006)) with mCherry from pmCherry-N1 (Invitrogen) ...
-
bioRxiv - Bioengineering 2023Quote: ... was transfected with 1 µL AAV1-hSyn1-GCaMP6f-P2A-nls-dTomato virus (Addgene viral prep #51085-AAV1, http://n2t.net/addgene:51085, RRID:Addgene 51085, a gift from Jonathan Ting) diluted 1 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... specified by “Cap” in primer name) or pKD4 (kanamycin resistance) (both vectors were a gift from Barry L. Wanner; Addgene plasmids #45604 or #45605) with ‘KO’-primers introducing 50 bp overhangs with homology to the respective target locus using PrimeStar GXL polymerase (Takara Bio) ...
-
Axon-secreted chemokine-like Orion is a signal for astrocyte infiltration during neuronal remodelingbioRxiv - Neuroscience 2020Quote: ... to recombine the inserts into the destination UAS vector pJFRC81-GW-2xMyc (L. G. F., unpublished) which was generated from pJFRC81-10XUAS-IVS-Syn21-GFP-p10 (Addgene plasmid 36462 deposited by G. Rubin43) by replacing the GFP ORF with a Gateway cassette adding on a C-terminal 2x Myc tag ...