Labshake search
Citations for Addgene :
1601 - 1650 of 1747 citations for L β Homo β 2 hydroxyphenyl glycine; R 3 Amino 3 2 hydroxyphenyl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... and 500 ng of each TALEN-L (Addgene #35431) and TALEN-R (Addgene #35432 ...
-
bioRxiv - Microbiology 2022Quote: ... Then pLNCX myr-Akt_K179M (Addgene #9906, a gift of William R. Sellers) was digested with SmaI + DraIII to release a 289 bp fragment containing the K179M mutation in the context of AKT1 ...
-
bioRxiv - Neuroscience 2024Quote: ... Vectors used and sources: AAV9.syn.flex.GcaMP6s (Addgene, Catalog# pNM V3872TI-R(7.5)) ...
-
bioRxiv - Cell Biology 2022Quote: ... with AgeI and BstBI restriction sites into the pLenti CMV/TO GFP-MDC1 (779-2) (plasmid #26285, Addgene, gift from E. Campeau; Genewiz) backbone ...
-
bioRxiv - Cell Biology 2020Quote: ... SKO cells were transfected with pSH-EFIRES-P-GFP(1-10)opti AAVS1 Safe Harbor integration plasmid (Addgene plasmid # 129416, [35] and pCas9-sgAAVS1-2 (Addgene plasmid # 129727 [47]), and a stable pool was selected using puromycin (1 µg/ml puromycin for 6 days ...
-
bioRxiv - Cancer Biology 2020Quote: pBABE-SAOS 2 and hTERT-SAOS 2 stable cell lines were obtained upon transfection of the SAOS 2 cell line with the plasmids pBABE-puro or pBABE-puro-hTERT from Addgene (#1764, #1771, respectively), and Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids encoding the SARS-CoV-2 open reading frames proteins and eGFP control were a kind gift of Nevan Krogan (Addgene plasmid #141367-141395). Plasmids were acquired as bacterial LB–agar stabs ...
-
bioRxiv - Neuroscience 2022Quote: ... All cell lines presented in this study are available from the corresponding author upon request and all plasmids are available from Addgene (Supplementary Table 2).
-
bioRxiv - Cancer Biology 2020Quote: ... HEK293T cells were transfected with psPAX2 and pMDG.2 packaging plasmids (gifts from Didier Trono, EPFL, Lausanne, Switzerland; Addgene plasmids 12559 and 12660) and the lentiviral expression construct ...
-
bioRxiv - Microbiology 2022Quote: ... were cloned from pLVX- EF1alpha-SARS-CoV-2-M-2xStrep-IRES-Puro and pLVX-EF1alpha-SARS-CoV-2-E-2xStrep- IRES-Puro (kind gifts from Nevan Krogan, available from Addgene #141386 and #141385) using PCR to remove the 2xStrep epitope tag ...
-
bioRxiv - Neuroscience 2020Quote: One adult mouse (~ 2 months) was stereotaxically injected with a GCaMP6f construct (AAV5.CamKII.GCaMP6f.WPRE.SV40 virus, Addgene # 100834; 0.4 μL at 0.06 μl/min) in hippocampal CA1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... HEK293T cells were transfected with psPAX2 and pMDG.2 packaging plasmids (gifts from Didier Trono, EPFL, Lausanne, Switzerland; Addgene plasmids 12559 and 12660), the lentiviral expression plasmid ...
-
bioRxiv - Neuroscience 2024Quote: ... Wild-type animals were then injected whether with mix 1 or mix 2 or AAV9-CamKII-GCaMP6f-WPRE-SV40 (Addgene, 100834, vg/mL) or AAV9-CamKII-hM4D(Gi)-mCherry (construct provided by Bryan Roth ...
-
bioRxiv - Biophysics 2022Quote: The plasmid encoding GPCR kinase subtype 2 used for the receptor phosphorylation in insect cells (GRK2-CAAX) was a gift from Robert Lefkowitz (Addgene plasmid #166224 49). Full-length arrestin21-418 (C150L ...
-
bioRxiv - Cancer Biology 2022Quote: ... shNFATC2IP#2: ACATTTGCTTGAGGCTTATAC) were cloned into Tet-pLKO-puro or TET-pLKO-neo vectors (gifts from Dmitri Wiederschain, Addgene plasmids #21915 and #21916). Hairpins were introduced by lentiviral transduction using pRSV-Rev (Addgene plasmid # 12253) ...
-
bioRxiv - Cell Biology 2023Quote: ... and EBP50-PDZ12 (aa 1-298) cloned into the pCMV-2-FLAG vector were gifts from Maria-Magdalena Georgescu (Addgene plasmids #28291-28297).
-
bioRxiv - Neuroscience 2024Quote: ... Gq DREADD virus (n=23, 12 males, 11 females: AAV8-hSyn-DIO-hM3Dq-mCherry, ≥ 4×101 2 vg/mL, Addgene; Watertown, MA, USA) was mixed with GAD1-cre to express excitatory designer receptors in VP GABA neurons ...
-
bioRxiv - Biochemistry 2020Quote: Recombinant wild-type Streptococcus pyogenes Cas9 REC3 domain (506-712) possessing an amino-terminal His10-MBP tag (Addgene, no. 101205) followed by a TEV protease site was expressed in Escherichia coli strain BL21(DE3 ...
-
bioRxiv - Molecular Biology 2020Quote: Human Drosha cDNA with a Flag-tag at the amino-terminus was cloned into pBABE-puro vector (Addgene plasmid#1764) for producing retrovirus of human Drosha wild type (WT) ...
-
bioRxiv - Neuroscience 2024Quote: ... containing AAV1-synapsin-l-GCamp6f (Addgene, MA stock #100837 (44)) and AAV9-CAMKII-mScarlet-C1V1-KV2.1 (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... the open reading frame was amplified by PCR from the pDONR223 SARS-CoV-2 NSP5 plasmid (Addgene, #141259, a gift from Fritz Roth [32]), including an ATG start codon in the forward primer and a TAA stop codon in the reverse primer (MPro_Fw ...
-
bioRxiv - Immunology 2020Quote: ... pcDNA3-sACE2(WT)-Fc(IgG1) and pcDNA3-SARS-CoV-2-S-RBD-sfGFP plasmids were gifts from Erik Procko (Addgene plasmids #145163 and #141184). pGBW-m4134096 encoding for SARS-CoV-2 M protein was a gift from Ginkgo Bioworks (Addgene plasmid #152039).
-
bioRxiv - Neuroscience 2023Quote: ... Michael Ward and the 2 CLYBL targeting TALEN plasmids (pZT-C13-R1 and pZT-C13-L1, gifts from Jizhong Zou Addgene.org: #52638 and 52637, respectively) by the same method with the Neon Transfection System (40) ...
-
bioRxiv - Neuroscience 2023Quote: Foreskin fibroblasts were transfected with the AAVS1-DOX-KRAB-dCAS9 plasmid and the 2 AAVS1 Talen plasmids (Gifts from Danwei Huangfu, Addgene plasmid # 59025 and 59026) using the Neon Transfection system (38) ...
-
bioRxiv - Cell Biology 2024Quote: ... The FAP-tagging plasmids and those expressing these FAP-tagged cellular markers are all available on Addgene (see Supplemental Table 2 or Addgene global deposit number 84326). Plasmids were transformed into yeast cells using the lithium acetate method (Ausubel ...
-
bioRxiv - Molecular Biology 2024Quote: ... 100 ng of CB1-GFP and 100 ng of R-GECO (Addgene #32444) were mixed with 0.2 µL of lipofectamine 2000 transfection reagent ...
-
bioRxiv - Molecular Biology 2022Quote: ... This construct was commercially synthesized (GeneArt) and cloned into 13S-R (Addgene # 48328) to produce pCR_Array/I-G (Table S4) ...
-
bioRxiv - Developmental Biology 2024Quote: ... The gene sequences encoding the amino-terminal 33 residues of endothelial nitric-oxide synthase as a Golgi targeting sequence (Addgene, 14873) and peroximal targeting signal 1 (Addgene ...
-
bioRxiv - Bioengineering 2022Quote: ... the modules in these plasmids (split Cas9, MCP, sgRNA cassette) were PCR-amplified and recloned into 2 lentiviral plasmids (pLKO.1 neo, Addgene #13425; pLJM-EGFP, Addgene #19319) and ...
-
bioRxiv - Neuroscience 2023Quote: 750 nl of rAAV.EF1a.DIO.hChR2(H134R).eYFP or rAAV.EF1a.DIO.eYFP (3-4 x 10^12 vg/ml, AAV5, University of North Carolina Vector Core; 1-2 x 10^13 vg/ml, AAV1, Addgene, 27056-AAV1 and 20298-AAV1) were injected into each hemisphere of the VTA of 3–4-month-old DAT-Cre mice ...
-
bioRxiv - Neuroscience 2024Quote: ... The efficiency of viral-genetic receptor KO was established in an separate experimental cohort of Esr1loxP or PRloxP animals which received unilateral MPOA injections of either AAV2/5-CMV-EGFP-Cre (250 nl, Addgene 105545, 2 × 1013 GC / ml) or AAV2/5-CMV-EGFP (250 nl ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid vector pHSP70-Cas9 (donated by L. B. Voshall, Addgene #45945) (Gratz et al. ...
-
bioRxiv - Microbiology 2023Quote: ... -L and -G-expressing plasmids (Addgene, 64087, 64088, 64085 and 8454), using TransIT-LT1 transfection reagent ...
-
bioRxiv - Molecular Biology 2020Quote: ... The Cre-containing plasmid was obtained from Addgene (pLM-CMV-R-Cre, Addgene #27546). A fragment encoding the CMV promoter and mCherry-T2A-Cre-WPRE was excised by NdeI and SacII (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... RA was PCR amplified from RA-NES (gift from R. Campbell, Addgene plasmid #61019) (Ding et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... GB was PCR amplified from GB-NES (gift from R. Campbell, Addgene plasmid #61017) (Ding et al. ...
-
bioRxiv - Microbiology 2024Quote: ... pcDNA-V5-NSP3 was generated by amplifying the full-length NSP3 ORF from pDONR207 SARS-CoV-2 NSP3 (Addgene #141257; a gift from Fritz Roth (86)) and by subcloning it into the pcDNA3-C-V5 vector ...
-
bioRxiv - Synthetic Biology 2022Quote: ... PCR with pKD3 (pKD3 was a gift from Barry L. Wanner; Addgene plasmid #45604 ...
-
bioRxiv - Biochemistry 2021Quote: ... and R-CEPIA1er (a gift from Masamitsu Iino, Nihon University, Tokyo, Japan; Addgene plasmid #58216) (Suzuki et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... 2011) (pCMV-VSV-G and pLKO.1 puromycin were gifts from R. Weinberg through Addgene), using Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Plant Biology 2022Quote: ... Primers GFP-F-EcoRI and 3xNLS-R were used to obtain GFP-3xNLS from Addgene plasmid pEGFP-C1 EGFP-3xNLS ...
-
bioRxiv - Immunology 2022Quote: ... target cells were derived by transfection with plasmids designed to express the SARS-CoV-2 D614 Spike protein with a c-terminus flag tag (kindly provided by Dr. Farzan, Addgene plasmid no. 156420 (Zhang et al., 2020)) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Each dsDNA was injected into CB4088 hermaphrodites at a final concentration of 10 µM with 9 ng plasmid pCFJ90 (Addgene #19327, myo-2>mCherry::unc-54 ‘UTR) as an injection marker ...
-
bioRxiv - Biophysics 2021Quote: ... we used the retinoic acid-responsive firefly luciferase expression vector pGL3-RARE-luciferase (Addgene plasmid #13458 ...
-
bioRxiv - Microbiology 2020Quote: ... The UPS reporter construct Ub-R-GFP was obtained as a gift from Nico Dantuma (Addgene plasmid # 11938 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Reporter assays to assess RUNX1 transcriptional activity were done using the pMCSF-R-luc plasmid (Addgene plasmid #12420 ...
-
bioRxiv - Neuroscience 2022Quote: ... The pDisplay-Gncp-iGluSnFR and pDisplay-R-iGluSnFR1 vectors were gifts from Dr Robert Campbell (Addgene plasmid #107337 and #107335 ...
-
bioRxiv - Molecular Biology 2020Quote: 1×106 cells of WTC p42 were transfected with 5mg AAVS1-TALEN R plasmid (Addgene #59026), 5 μg AAVS1-TALEN L plasmid (Addgene #59025) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2012) were cloned into the pLKO.1-Puro vector (a gift from R. Weinberg; Addgene #8453) to generate pLKO.1-Cys-TD and pLKO.1-Scr-TD ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids Ub-M-GFP and Ub-R-GFP were a gift from Nico Dantuma (Addgene #11939) (Dantuma et al. ...