Labshake search
Citations for Addgene :
1651 - 1700 of 1747 citations for L β Homo β 2 hydroxyphenyl glycine; R 3 Amino 3 2 hydroxyphenyl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... and pBabe-puro-IRES-EGFP (a gift from L. Miguel Martins; Addgene #14430) as a control ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmid used for calcium imaging CMV-mito-R-GECO1 was a gift from Robert Campbell (Addgene plasmid #46021 ...
-
bioRxiv - Bioengineering 2020Quote: ... either of the two cell types was subjected to Lipofectamine transfection with CMV-R-GECO1.2-mCherry (Addgene, Watertown ...
-
bioRxiv - Cancer Biology 2021Quote: The M-CSF promoter reporter (pMCSF-R-luc Addgene plasmid # 12420; http://n2t.net/addgene:12420; RRID: Addgene_12420)(Zhang et al. ...
-
bioRxiv - Synthetic Biology 2020Quote: Ub-R-GFP was a gift from Nico Dantuma (Addgene plasmid # 11939; http://n2t.net/addgene:11939; RRID:Addgene_11939). Site directed mutagenesis was performed to generated Ub M-GFP and Ub-L-GFP using Q5 Hot Start High-Fidelity Polymerase New England Biolabs (Ipswich ...
-
bioRxiv - Biochemistry 2021Quote: ... Ub-M–GFP (#11938) and Ub-R–GFP (#11939) plasmids described in [45] were purchased from Addgene. HA tagged USP5 (#22590 ...
-
bioRxiv - Bioengineering 2021Quote: ... with 1000 ng of reporter and 500 ng of each TALEN-L (Addgene #35431) and TALEN-R (Addgene #35432 ...
-
bioRxiv - Molecular Biology 2020Quote: ... pMXs-Hu-N-Myc and pMXs-Hu-L-Myc plasmids were obtained from Addgene. The pCCL-WSB1 and pCCL-c-Myc plasmids were purchased from Genscript ...
-
bioRxiv - Microbiology 2024Quote: ... such that gene could be inserted by Gibson Assembly into p15TV-L (Addgene #26093) linearized by BseRI digestion to produce the expression vector p15TVL-AcdA ...
-
bioRxiv - Genomics 2024Quote: ... 1000 ng of pJT039 and 500 ng of each TALEN-L (Addgene no. 35431) and TALEN-R (Addgene no ...
-
bioRxiv - Microbiology 2020Quote: ... The UPS reporter construct Ub-R-GFP was obtained as a gift from Nico Dantuma (Addgene plasmid # 11938; http://n2t.net/addgene:11938; RRID:Addgene_11938) and sub-cloned into the pKT3 plasmid using the NheI and SmaI sites ...
-
bioRxiv - Cancer Biology 2021Quote: ... Reporter assays to assess RUNX1 transcriptional activity were done using the pMCSF-R-luc plasmid (Addgene plasmid #12420; http://n2t.net/addgene:12420; RRID:Addgene_12420) (Zhang et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... and nuclear (CMV-NLS-R-GECO) targeted calcium biosensors were gifts from Robert Campbell (Addgene #61244, and 32462) [40,41] ...
-
bioRxiv - Cell Biology 2021Quote: ... the sequence coding for R-GECO1 including TorA-tag from pTorPE-R-GECO1 (a gift from Robert Campbell (Addgene plasmid #32465; http://n2t.net/addgene:32465; RRID:Addgene_32465), and (iv ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... HEK-293 cells were transfected with two plasmid vectors CMV–R-GECO1 (a gift from Robert Campbell, Addgene plasmid #32444 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... HEK-293 cells were transfected with two plasmid vectors CMV–R-GECO1 (a gift from Robert Campbell, Addgene plasmid #32444; http://n2t.net/addgene:32444; RRID:Addgene_32444) and PH(Akt)-Venus (a gift from Narasimhan Gautam ...
-
bioRxiv - Biophysics 2023Quote: ... generated by us in the Kiel center [51] using a modified version of the pHyVec1 plasmid which replaces the GFP sequence with a GCaMP6s sequence that was codon-optimized for Hydra (HyGCaMP6s was a gift from R. Yuste lab (Addgene plasmid # 102558; http://n2t.net/addgene:102558 ; RRID:Addgene_102558) [37]) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The TIS11B coding sequence was amplified from pcDNA3.1-puro-GFP-TIS11B using TIS11B MCP F and TIS11B MCP R primers and the TIAL1 coding sequence was PCR amplified from pFRT_TO_FlagHA_TIAL1 (Addgene 106090) using TIAL1 MCP F and TIAL1 MCP R primers.
-
bioRxiv - Cancer Biology 2023Quote: ... PGL2 E-cad (108) Ebox Mut-Luc (kindly provided Dr. Eric R. Fearon, Addgene plasmids 19291 and 19290), and 0.025 μg of pRL-TK (Promega ...
-
bioRxiv - Immunology 2023Quote: ... whereas mCherry1-10-RNase L was inserted into pLenti-PGK-PuromycinR plasmid (Addgene: Plasmid #19070). The mRuby-OAS3 CDS and mRuby2 were amplified via PCR and primers (Supplemental table 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... CMV-R-GECO1 (32) and pDDRFP-A1B1-DEVD (75) were gifted by Robert Campbell (Addgene plasmid #32444 and #36294). pcDNA3-HA-human OCRL (76 ...
-
bioRxiv - Bioengineering 2020Quote: ... VPR was amplified by primer pair VPR-F/R (template source: pWalium20-10XUAS-3XFLAG-dCas9-VPR (Addgene No.: # 78897)(Lin et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmid used for calcium imaging CMV-mito-R-GECO1 was a gift from Robert Campbell (Addgene plasmid #46021; http://n2t.net/addgene: 46021; RRID: Addgene_46021).
-
bioRxiv - Bioengineering 2021Quote: ... R-GECO expression was done with lipofectamine 3000 using the Addgene plasmid CMV-R-GECO-1.2 at 400 ng per sample (Catalog #45494, Addgene), courtesy of Robert Campbell [26] ...
-
bioRxiv - Cancer Biology 2021Quote: ... All the sgRNAs were designed using Benchling Life Sciences R&D Cloud Software (https://benchling.com/) and cloned into the pSpCas9(BB)puroV2.0 vector (Addgene #62988), which expresses both Cas9 and puromycin resistance genes23,24 ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... plasmid pU6-BbsI-chiRNA-dilp8_gRNA1 was generated by cloning the annealed primers #200_DILP8-GuideRNA_1_F “CTTCGCACTGGTTTAGACAGCAGT” and #201_DILP8-GuideRNA_1_R “AAACACTGCTGTCTAAACCAGTGC” into BbsI-digested pU6-BbsI-chiRNA [a gift from Melissa Harrison & Kate O’Connor-Giles & Jill Wildonger (Addgene plasmid # 45946 ...
-
bioRxiv - Cell Biology 2021Quote: ... R-GECO and mito-LAR-GECO were gifts from Robert Campbell (University of Alberta, Addgene plasmid 32444 and 61245) (Wu et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... or GFP and Synaptophysin-RFP cDNA (pRVdG-N-P-M-EGFP-SynPhRFP-L, Addgene plasmid #52483), and with these additional plasmids ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1 μl of AAV1 particles with pAAV.Syn.NES-jRGECO1a.WPRE.SV40 (at titer ≥ 1 × 1010 vg/ml) (both from Addgene). Neurons had significant ChR2 and jRGECO1a expression by day in vitro (DIV ...
-
bioRxiv - Biophysics 2021Quote: ... we used the retinoic acid-responsive firefly luciferase expression vector pGL3-RARE-luciferase (Addgene plasmid #13458; http://n2t.net/ad-dgene:13458; RRID:Addgene_13458), a gift from T ...
-
bioRxiv - Developmental Biology 2021Quote: ... The predicted r-opsin1 TALENs were constructed in vitro using Golden Gate assembly protocol (Golden Gate TAL Effector Kit 2.0, Addgene #1000000024) [88] ...
-
bioRxiv - Plant Biology 2021Quote: ... including a 2385 bp region upstream of the ATG start codon and a 294 bp region downstream of the TAG stop codon was PCR amplified with oligonucleotides MTOPVI-Prom-SalI-F and MTOPVI-Term-NotI-R and cloned between SalI and NotI restriction endonuclease sites into pGreen0029 vector (Addgene), to yield the pGreen-gMTOPVIB construct ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The GFP fragment was amplified and C-terminally Flag-tagged using primers GFP_IndOE_F & R and the construct pT2-CAG-fGFP (Addgene plasmid #108714) as template ...
-
bioRxiv - Molecular Biology 2022Quote: ... R179A and R320A were PCR amplified and cloned into pET Strep II co-transformation cloning vector (13S-R, Addgene # 48328). Csb3/I-G was cloned into pQE2 (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... The nSauCas9D10A plasmid used for the orthogonal R-loop assay was also cloned by SDM using CMV-dSauCas9 (Addgene #138162) as a template ...
-
bioRxiv - Biophysics 2023Quote: ... generated by us in the Kiel center [51] using a modified version of the pHyVec1 plasmid which replaces the GFP sequence with a GCaMP6s sequence that was codon-optimized for Hydra (HyGCaMP6s was a gift from R. Yuste lab (Addgene plasmid # 102558 ...
-
bioRxiv - Molecular Biology 2023Quote: ... YFP–Parkin was introduced using retroviral transduction with the pBMN-YFP-Parkin plasmid (gift from R. Youle; Addgene plasmid, 59416), followed by fluorescence sorting ...
-
bioRxiv - Biochemistry 2024Quote: The pNLS-mTagBFP2 plasmid used as an internal control of transfection efficiency was obtained by PCR amplification of the 2xNLS-mTagBFP2 coding sequence with mTagBFP-Acc65-F and mTagBFP-Mlu-R primers on the pHAGE-TO-nls-st1dCas9-3nls-3XTagBFP2 plasmid template (a gift from Thoru Pederson ; Addgene plasmid # 64512 ...
-
bioRxiv - Biochemistry 2024Quote: ... The Cpf1 and guide RNA co-expression plasmid used to cleave the reporter substrate was generated by inserting the pre-annealed gRNA-GF-F and gRNA-GF-R oligonucleotides into the Esp3I restriction sites of pTE4398 (a gift from Ervin Welker ; Addgene plasmid # 74042 ...
-
bioRxiv - Physiology 2024Quote: ... Lyn-R-GECO1 (gift from Won Do Heo (Addgene plasmid # 120410 ; http://n2t.net/addgene:120410 ; RRID:Addgene_120410; (Kim et al., 2016)) ...
-
bioRxiv - Cell Biology 2024Quote: Mitochondrial Ca2+ levels in HeLa cells were determined with cells that were transiently transfected with pCMV R-Cepia3mt (Addgene #140464). These transfected cells were first perfused for 30 min with HBSS to record a baseline signal ...
-
bioRxiv - Neuroscience 2023Quote: 1-4 evenly spaced ∼60 nl injections of the AAV1-synapsin-l-GCamp6f (Addgene, MA stock #100837) that had been diluted to a titer of ∼1×10^12 vg/mL using sterile PBS were made in each cranial window ...
-
bioRxiv - Molecular Biology 2020Quote: ... The first fragment was amplified using p15-Cam-F and p15-Cam-R (Table 1) from the plasmid pEVOL-pBpF (Addgene #31190), and the second fragment was obtained from the pBAD/HisB vector (Invitrogen ...
-
bioRxiv - Genomics 2020Quote: ... The Lenti-CMV-mCherry-P2A-CRE (aka pLM-CMV-R-Cre) plasmid was a gift from Michel Sadelain (Addgene plasmid #27546) (34) ...
-
bioRxiv - Cell Biology 2022Quote: ... T2A-GFP fragment was amplified by T2A-F and GFP-R primers using plenti-CMV-mCherry-T2A-GFP (Addgene plasmid #109427) as a template ...
-
bioRxiv - Cell Biology 2021Quote: ... Real time analysis of NFAT4-GFP nuclear translocation in response to 10 µM Cch stimulation was calculated using the equation: Quantification of ER Ca2+ store depletion and refilling was measured by transfecting parental and MCU-KO HEK293 cells with red R-CEPIA1er (Addgene: #58216) using Lipofectamine 24 hrs prior to imaging ...
-
bioRxiv - Biochemistry 2020Quote: D3cpV-px (PST 1738) was generated from (pcDNA-)D3cpV (kind gift from A. Palmer and R. Tsien (Palmer et al., 2006) (Addgene #36323)) by amplifying an insert with OST 1599 (GCGCATCGAT GGTGATGGCC AAGTAAACTA TGAAGAG ...
-
bioRxiv - Cell Biology 2022Quote: ... was amplified by PCR using oligonucleotide primers Pac1-paGFP-F (GGGTTAATTAACGTGAG-CAAGGGCGAGGAG) and Asc1-paGFP-R (AGTGGCGCGCCCTACTTGTACAGCTCGTCCATGCC) and the product was cloned into pFA6a-GFP(S65T)-kanmx6 (Addgene 39292) digested with Pac1/Asc1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... in transformed fibroblasts was achieved by transient expression of Cre recombinase by transfection with the plasmid pLM-CMV-R-Cre (Addgene, 27546), which codes for mCherry-Cre recombinase ...
-
bioRxiv - Plant Biology 2023Quote: ... we amplified a 10xHis-MBP coding fragment by PCR with primers pair 10xHis-MBP-F and 10xHis-MBP-R from pMAL-c2X® vector (Addgene), and cloned it into pTrcHis® vector (Addgene ...