Labshake search
Citations for Addgene :
101 - 150 of 3696 citations for pLenti CMV TO Puro DEST 670 1 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... the lentiviral GFP expression vector (pLenti CMV GFP Puro; Addgene, plasmid 17448), and the plasmids encoding GFP (Clontech ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLenti CMV Puro LUC (w168-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17477 ...
-
bioRxiv - Biochemistry 2024Quote: ... puromycin (Sigma-Aldrich, 1 μg/mL for three days; pLenti CMV Puro – Addgene plasmid #17452), blasticidin (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2024Quote: ... pENTR1a-PARP1 L713F-C-GFP was transferred to pLenti CMV Blast DEST (Addgene plasmid #17451).
-
bioRxiv - Biochemistry 2022Quote: ... which was then used as a donor to transfer mitoLbNOX into pLenti-CMV-Hygro-DEST (w117-1) (Addgene, 17454 a gift from Eric Campeau & Paul Kaufman ...
-
bioRxiv - Cancer Biology 2024Quote: ... WT and mutant constructs were subsequently cloned into the vector pLenti CMV Neo DEST (705-1) (Addgene, #17392) by the GATEWAY cloning system ...
-
bioRxiv - Biochemistry 2023Quote: ... pLenti-CMV-Hygro (w117-1) (Addgene, 17454 a gift from Eric Campeau & Paul Kaufman) ...
-
bioRxiv - Microbiology 2024Quote: ... We performed codon optimization for the sgRNA binding sites of the target genes and switched to pLenti-Hygro plasmid backbone pLenti CMV Hygro DEST (Addgene, 17454) for lentivirus packaging ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a WPRE (cloned from pLenti CMV GFP Puro (658-5) (Addgene #17448)) all flanked by epigenetic insulator sequences by repetitive restriction digests (KflI-EcoRI ...
-
bioRxiv - Cell Biology 2022Quote: ... PKM2 and PKM2 mutants into pLenti-CMV-MCS-GFP-SV-puro (Addgene, 73582).
-
bioRxiv - Cell Biology 2020Quote: ... and then sub-cloned into pLenti-CMV/TO-DEST (gift from E. Campeau, Addgene plasmid #17291) (Campeau et al. ...
-
bioRxiv - Pathology 2020Quote: ... all inserts were sub-cloned to an expression vector containing hygromycin resistance (pLenti CMV Hygro DEST 117-1, Addgene) using the Gateway recombination system ...
-
bioRxiv - Immunology 2024Quote: ... DLD-1 wild type cells were transduced with pLenti-CMV-MCS-RFP-SV-puro (Addgene plasmid #109377) viral particles (DLD-RFP ...
-
bioRxiv - Cell Biology 2022Quote: ... Enhanced GFP (EGFP) was PCR cloned from pLenti CMV GFP Puro (Addgene 658-5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8-pCHD at the SalI and BamHI restriction sites.
-
bioRxiv - Cancer Biology 2024Quote: ... Drp1 coding sequence were subcloned into pLenti-CMV-MCS-GFP-SV-puro (Addgene, 73582) with a N-terminal GFP tag and sequenced to confirm successful cloning of Drp1(−/17 ...
-
bioRxiv - Immunology 2023Quote: ... pLenti CMV rtTA3 Blast (Addgene w756-1) stably expressing clonal RAW MΦs were transduced with pLenti CMV Puro DEST (Addgene w118-1 ...
-
bioRxiv - Biophysics 2020Quote: ... as per the manufacturer’s instructions into pLenti CMV Hygro DEST (W117-1, a gift from Dr. Eric Campeau & Dr. Paul Kaufman, Addgene #17454) to create the final vector which was sequence verified by Sanger sequencing (Australian Genome Research Facility) ...
-
bioRxiv - Cancer Biology 2023Quote: ... cloned into pLenti PGK Neo DEST (pLenti PGK Neo DEST (w531-1) a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 19067) by using the Gateway LR Clonase II Enzyme Mix (Invitrogen).
-
bioRxiv - Molecular Biology 2020Quote: ... A lentiviral backbone was obtained from Addgene (pLenti-puro, Addgene #39481) and the CMV promoter was removed to prevent aberrant transcription by digesting the plasmid with ClaI-HF and BamHI-HF (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... pLenti-Guide-Puro (Addgene #52963 ...
-
bioRxiv - Immunology 2022Quote: ... pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17448 ...
-
bioRxiv - Microbiology 2022Quote: The amplified V5-MOSPD2 was subsequently inserted into pLenti-CMV-puro (Addgene plasmid no. 17452). MOSPD2 CRISPR guides for MOSPD2 (A3 and A4 ...
-
bioRxiv - Bioengineering 2022Quote: ... pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau & Paul Kaufman (RRID:Addgene_17448)[33] ...
-
bioRxiv - Biochemistry 2022Quote: pLenti-CMV-MCS-GFP-SV-puro was a gift from Paul Odgren (Addgene plasmid # 73582) FLAG-MTID synthetic gene:
-
bioRxiv - Microbiology 2022Quote: ... and pLenti-X2-Zeo-DEST (Addgene, 21562) were used to generate cells which stably express GFP ...
-
bioRxiv - Cancer Biology 2024Quote: ... pLenti CMV rtTA3 Hygro (w785-1) (Addgene: 26730), pCW57.1-4EBP1_4xAla (Addgene ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... The destination vector used in this study was pLenti CMV Neo DEST (705-1) (gift from Eric Campeau & Paul Kaufman; Addgene plasmid #17392). Once validated ...
-
bioRxiv - Developmental Biology 2023Quote: ... The destination vector used in this study was pLenti CMV Neo DEST (705-1) (gift from Eric Campeau & Paul Kaufman; Addgene plasmid #17392). Once validated ...
-
bioRxiv - Microbiology 2023Quote: The following plasmids were used in this study: pLenti CMV Blast DEST (706–1) (Ax203, a gift from Eric Campeau & Paul Kaufman, Addgene plasmid #17451); K8.1-OneStrep (OneStrep Tag ...
-
bioRxiv - Immunology 2021Quote: ... pLenti CMV-GFP-TAV2A-LUC Hygro was generated from pLenti CMV GFP Hygro (Addgene #17446) by addition of T2A-Luciferase by PCR cloning ...
-
bioRxiv - Molecular Biology 2020Quote: ... open reading frames were cloned into pLenti CMV GFP Neo/Blast/Puro (Addgene 17447, 17445, 17448). Constructs were transfected into 293FT cells together with psPAX2 (Addgene 12260 ...
-
bioRxiv - Cell Biology 2020Quote: ... respectively) and subcloned into pLenti-CMV-MCS-GFP-SV-puro (a gift from Paul Odgren, Addgene plasmid #73582 ...
-
bioRxiv - Cell Biology 2021Quote: ... Plenti-CMV-MCS-RFP-SV-puro was a gift from Jonathan Garlick & Behzad Gerami-Naini (Addgene plasmid # 109377 ...
-
bioRxiv - Bioengineering 2023Quote: ... and cloned as a BamHI/SalI fragment in the pLenti CMV GFP Puro (Addgene plasmid # 17448) to replace an ORF of GFP.
-
Cellular sialoglycans are differentially required for endosomal and cell-surface entry of SARS-CoV-2bioRxiv - Microbiology 2024Quote: ... Transfer plasmids pHAGE-Luc-ZsGreen (BEI Resources #NR-52519) or pLenti-CMV-Puro-Luc (Addgene #17477) were used ...
-
bioRxiv - Cancer Biology 2020Quote: ... V5/His-tagged pLenti-puro-LacZ and pLenti-puro-ARID1A were obtained from Addgene.
-
bioRxiv - Cancer Biology 2022Quote: ... SCD ORF was cloned in pLenti PGK Puro DEST 5W(w529-2) (gift from Eric Campeau & Paul Kaufman73; Addgene plasmid #19068 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Luciferase was introduced into pediatric brain tumor cell lines using lentiviral plasmids: pLenti CMV Puro LUC (w168-1) was a gift from Eric Campeau & Paul Kaufman(45) (Addgene plasmid # 17477 ...
-
bioRxiv - Cancer Biology 2021Quote: ... MCF7 and MCF7-F cells were infected with pLenti-CMV-puro-Luc lentiviral luciferase construct (Addgene 17477) to monitor tumor growth ...
-
bioRxiv - Physiology 2020Quote: ... pLenti-CMV-GFP-Puro (Witwicka et al., 2015) was a gift from Paul Odgren (Addgene plasmid #73582). The following primers were used to genotype VPS41 KO INS-1 cells ...
-
bioRxiv - Cell Biology 2023Quote: ... pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17448). mito-BFP was a gift from Gia Voeltz (Addgene # 49151) ...
-
bioRxiv - Cancer Biology 2023Quote: Engineering of Luc-tagged HCC1954 cells (HCC1954-Luc) and tumour implantation: the pLenti CMV Puro LUC (w168-1) was purchased from Addgene (#17477) and used in all in vivo experiments ...
-
bioRxiv - Microbiology 2022Quote: ... transfections were performed using the the pLenti-CMV-DEST vectors together with the lentivirus envelope and package plasmids pMD2.G (Addgene, #12259) and psPAX2 (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... The cagA cDNA with the EF promoter was recombined in vitro with the viral Destination vector pLenti CMV GFP DEST (Addgene, #19732) using the Gateway System (Invitrogen) ...
-
bioRxiv - Systems Biology 2021Quote: ... Both color variants of PKAR-FKBP-FP were cloned into pLenti CMV puro destination vectors (Addgene plasmid #17452). Lyn-FRB was cloned into the pLenti CMV blast destination vector (Addgene plasmid #17451) ...
-
bioRxiv - Cancer Biology 2023Quote: ... using pLenti_mENPP1_fwd and pLenti_mENPP1_rev primers in Table S1 and inserted into the XbaI-BamHI sites of pLenti-CMV-GFP-Puro (Addgene). To clone pLenti-CMV-mENPP1-T238A-GFP-Puro plasmid ...
-
bioRxiv - Bioengineering 2024Quote: pLenti-CFTR-wt-ires-PURO and pLenti-CFTR-F508del-ires-PURO plasmids were cloned starting from a pLenti-FNLS-P2A-Puro plasmid (Addgene, #110841), substituting the BE4max-P2A-Puro sequence with CFTR-ires-PURO derived by PCR on the pCHMWS-CFTR plasmids ...
-
bioRxiv - Cancer Biology 2024Quote: pLenti CMV V5-LUC Blast (Addgene; 21474) was used for luciferase overexpression.
-
bioRxiv - Cell Biology 2024Quote: ... elegans expression plasmid pPD49.26 by PCR and cloned into the pLenti PGK Puro DEST (w529-2) vector backbone (Addgene plasmid # 19068) by MultiSite Gateway cloning according to the manufacturers protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... elegans expression plasmid pPD49.26 by PCR and cloned into the pLenti PGK Puro DEST (w529-2) vector backbone (Addgene plasmid #19068) by MultiSite Gateway cloning according to the manufacturers protocol ...