Labshake search
Citations for Addgene :
51 - 100 of 3696 citations for pLenti CMV TO Puro DEST 670 1 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... luciferase reporter plasmid pLenti-CMV Puro-Luc (Addgene) and S protein expressing pcDNA3.1-SARS CoV-2 SΔCT were co-transfected into HEK293T cells by lipofectamine 2000 (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2021Quote: ... luciferase reporter plasmid pLenti-CMV Puro-Luc (Addgene), and spike protein expressing pcDNA3.1-SARS-CoV-2 SΔCT were co-transfected into HEK293T cells with calcium phosphate ...
-
bioRxiv - Microbiology 2022Quote: ... and pLenti CMV Puro GFP (Addgene plasmid #17448) vectors were a gift from Eric Campeau and Paul Kaufman [84] ...
-
bioRxiv - Molecular Biology 2021Quote: ... luciferase reporter plasmid pLenti-CMV Puro-Luc (Addgene), and spike protein expressing pcDNA3.1-SARS CoV-2 SΔCT were co-transfected into HEK293T cells by lipofectamine 2000 (ThermoFisher) ...
-
bioRxiv - Immunology 2021Quote: ... luciferase reporter plasmid pLenti-CMV Puro-Luc (Addgene), and spike protein expressing pcDNA3.1-SARSCoV-2 SΔCT of variants were co-transfected into HEK293T cells by lipofectamine 2000 (ThermoFisher) ...
-
bioRxiv - Immunology 2021Quote: ... luciferase reporter plasmid pLenti-CMV Puro-Luc (Addgene), and spike protein expressing pcDNA3.1-SARS CoV-2 SΔCT of variants were co-transfected into HEK293T cells by lipofectamine 2000 (ThermoFisher) ...
-
bioRxiv - Immunology 2021Quote: ... luciferase reporter plasmid pLenti-CMV Puro-Luc (Addgene), and spike protein expressing pcDNA3.1-SARS-CoV-2 SΔCT were co-transfected into HEK293T cells with calcium phosphate ...
-
bioRxiv - Microbiology 2021Quote: ... luciferase reporter plasmid pLenti-CMV Puro-Luc (Addgene), and spike protein expressing pcDNA3.1-SARS CoV-2 SΔCT of variants were co-transfected into HEK293T cells by lipofectamine 2000 (ThermoFisher) ...
-
bioRxiv - Immunology 2021Quote: ... luciferase reporter plasmid pLenti-CMV Puro-Luc (Addgene), and Spike protein expressing pcDNA3.1-SARS CoV-2 SΔCT of variants were co-transfected into HEK293T cells by lipofectamine 2000 (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2024Quote: ... or pLENTI-CMV-GFP-Puro (Addgene, cat#17448) vectors ...
-
bioRxiv - Immunology 2024Quote: ... luciferase reporter plasmid Plenti-CMV Puro-Luc (Addgene), and the plasmids expressing the virulent-Env ...
-
bioRxiv - Bioengineering 2024Quote: ... The plasmid pLenti-CMV-GFP-Puro (Addgene #17448) containing lenti packaging elements ...
-
bioRxiv - Cancer Biology 2023Quote: ... and further sub-cloned into pLenti CMV Blast DEST (706-1) (Addgene, #17451) (Campeau et al ...
-
bioRxiv - Cell Biology 2020Quote: ... which was recombined into pLenti X1 Puro DEST (Addgene#17297). These lentivirus entry and destination plasmids were a gift from Eric Campeau and Paul Kaufman [17] ...
-
bioRxiv - Cancer Biology 2022Quote: ... into the destination plasmid pLenti X1 Puro DEST (Addgene #17297) (Campeau et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... pLenti CMV/TO Zeocin DEST with either human XBP1s insert (Addgene), and pLenti CMV hygromycin DEST with a DHFR.ATF6(1-373 ...
-
bioRxiv - Systems Biology 2021Quote: ... and the lentiviral expression vector pLenti CMV Hygro DEST (Addgene #17454) generating the final product ...
-
bioRxiv - Cancer Biology 2022Quote: ... Both were subsequently cloned into pLenti-CMV-Hygro-DEST (Addgene # 17454) by gateway cloning ...
-
bioRxiv - Cancer Biology 2023Quote: ... into a pLenti CMV Hygro DEST vector (Addgene, Cambridge, MA, USA) using Gateway LR recombination cloning technology (Life Technologies ...
-
bioRxiv - Genetics 2020Quote: ... BLRR was then transferred to pLenti CMV Puro DEST (w118-1)(33) (a kind gift from Eric Campeau & Paul Kaufman; Addgene plasmid #17452) from pENTR-BLRR using Gateway LR Clonase II Enzyme mix (111791020 ...
-
bioRxiv - Immunology 2020Quote: ... luciferase reporter plasmid pLenti-CMV Puro-Luc (Addgene, USA), and spike protein expressing pcDNA3.1-SARS CoV-2 SΔCT were co-transfected into HEK293T cells with calcium phosphate ...
-
bioRxiv - Immunology 2021Quote: ... 2) luciferase reporter plasmid pLenti-CMV Puro-Luc (Addgene), and 3 ...
-
bioRxiv - Bioengineering 2022Quote: ... and the pLenti-CMV-GFP-Puro plasmid (Addgene #17448) as previously described [66] ...
-
bioRxiv - Cell Biology 2024Quote: pLenti-CMV-MCS-GFP-SV-puro (Addgene plasmid #73582) was a gift from Katarzyna Mleczko-Sanecka ...
-
bioRxiv - Immunology 2024Quote: ... a luciferase reporter plasmid pLenti-CMV Puro-Luc (Addgene), packaging construct psPAX2 (AIDS Resource and Reagent Program) ...
-
bioRxiv - Cancer Biology 2024Quote: ... pLenti CMV/TO V5-LUC Puro (Addgene plasmid #19785) was a gift from Prof ...
-
bioRxiv - Immunology 2021Quote: ... and then recombined into the destination vector pLenti CMV Blast DEST (706-1, Addgene) plasmid ...
-
Ribonuclease Inhibitor and Angiogenin collaboratively regulate cell-type-specific global translationbioRxiv - Biochemistry 2024Quote: ... and then recombined into the destination vector pLenti CMV Blast DEST (706-1, Addgene) plasmid using the Gateway cloning method.
-
bioRxiv - Systems Biology 2022Quote: ... Lentivirus expressing GFP was produced by co-transfection of HEK293ft cells with the following plasmids: plenti-CMV-Puro-DEST (Addgene #17452 ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviral constructs of wildtype CaMKK2 were created by shuttling CaMKK2 from the pDONR221 vector backbone to pLenti-CMV-puro-DEST (Addgene) using Gateway cloning ...
-
bioRxiv - Cell Biology 2024Quote: ... Hoechst 33342 came from Thermo-Fisher (Cat. #H1399). The ERK fluorescent biosensor (pLenti-CMV-Puro-DEST-ERK-KTR-mClover; Cat. #59150) was from Addgene.
-
bioRxiv - Cell Biology 2020Quote: ... pLenti CMV hygro DEST (a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17454 ...
-
bioRxiv - Microbiology 2020Quote: ... gift from Eric Campeau & Paul Kaufman) or plenti-CMV-Hygro-DEST (Addgene, #17454 ...
-
bioRxiv - Cancer Biology 2023Quote: ... was cloned on the lentiviral backbone pLenti CMV hygro dest (Addgene #17454). HEK293T cell transfection and infection of target cells was performed by Calcium Chloride followed by hygromycin B (InvivoGen ...
-
bioRxiv - Cell Biology 2020Quote: ... lentivirus entry vector backbone at BamH1 and XbaI restriction sites followed by LR clonase mediated gateway recombination in 3rd generation lentivirus destination vector pLenti CMV Puro Dest (Addgene#17452). shRNA oligos(Oligo 1:5’-GATCCCACCAGAAGAATCCCAGAATCTCGAGATTCTGGGATTCTTCTGGTGGTTTT TG-3’ and Oligo 2:5’-AGCTCAAAAACCACCAGAAGAATCCCAGAATCTCGAGATTCTGGGATTCTTCTGGT GG-3’ ...
-
bioRxiv - Immunology 2023Quote: ... Lentiviral vector pLenti-CMV-Puro-DEST containing EGFP-rNLRP1-MYC was transfected into Lenti-X cells together with packaging plasmid psPAX2 (Addgene #12260) and Lentiviral envelope plasmid pMD2.G (Addgene #12259 ...
-
bioRxiv - Immunology 2023Quote: ... was amplified and flanked with an EGFP tag at the N-terminus and an MYC epitope at the C-terminus before the stop codon followed by cloning into EcoRV-linearized pLenti-CMV-Puro-DEST plasmid (Addgene #17452) using Gibson Assembly.
-
bioRxiv - Cancer Biology 2024Quote: ... as template respectively and then cloned into plenti CMV Neo DEST (705-1) (Addgene, #17392) by In-Fusion HD Cloning Kits (TaKaRa ...
-
bioRxiv - Molecular Biology 2022Quote: ... pLenti-CMV-GFP-Puro plasmid was obtained from Addgene (17448). Plasmid p3XFLAG -CMV-7.1 was obtained from Sigma (E7533).
-
bioRxiv - Cancer Biology 2022Quote: ... was cloned into the pLenti-CMV-Puro vector (Addgene, 17448) and lentivirus generated to produce stable cell lines expressing the biosensor as described ...
-
bioRxiv - Microbiology 2024Quote: ... pLenti-CMV-GFP-Puro (plasmid #17448) was obtained from Addgene. To generate pLenti-CMV-hAPN-Puro ...
-
bioRxiv - Microbiology 2024Quote: ... and subcloned into pLenti-CMV-GFP-Puro (Addgene Plasmid #17448). pHAGE2-EF1aInt-TMPRSS2-IRES-mCherry plasmid was kindly provided by Dr ...
-
bioRxiv - Biophysics 2022Quote: ... pLenti CMVTRE3G Puro DEST (w811-1) was a gift from Eric Campeau (Addgene plasmid # 27565). Both plasmids harbor a puromycin- resistant gene as a marker for antibiotic selection ...
-
bioRxiv - Biochemistry 2022Quote: ... and then shuttled as a mixture of DNAs into the pLenti CMV Puro DEST vector (gift from Eric Campeau and Paul Kaufman, Addgene plasmid # 17452) via an LR clonase II reaction (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... pLenti DEST CMV Puro-GRET/PalmGRET plasmids were created by Gateway LR cloning with pENTR-GRET/PalmGRET and pLenti DEST CMV Puro plasmids (a gift from Drs. Eric Campeau and Paul Kaufman; Addgene plasmid #17452)[59] using LR Clonase II Plus (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... was cloned into pINDUCER20 (Meerbrey et al., 2011) and pLenti CMV Blast DEST (706-1) (Addgene plasmid #17451 was a gift from Eric Campeau & Paul Kaufman ...
-
bioRxiv - Microbiology 2020Quote: ... pLenti CMV Blast DEST (706-1) (a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17451)) constructs carrying a human Plxdc1-TwinStrep or Plxdc2-TwinStrep expression cassette (pLenti-CMV-Blast-Plxdc1-Strep/ pLenti-CMV-Blast-Plxdc2-Strep ...
-
bioRxiv - Biochemistry 2022Quote: ... HEK293T cells (~20 million) stably expressing pLenti-CMV-puro (Addgene 17452) empty vector ...
-
bioRxiv - Biochemistry 2022Quote: ... Then 3XFLAG-PRLs were cloned into pLenti-CMV-puro (Addgene 17452) to make plenti-CMV-3XFLAG-PRL-puro constructs.
-
bioRxiv - Cell Biology 2023Quote: pLenti-CMV-MSC-RFP-SV-Puro vector was purchased from Addgene (#109377) and used as a control vector or backbone for further cloning ...