Labshake search
Citations for Addgene :
101 - 150 of 2453 citations for 1 Benzyl 3 Tert Butyldimethylsilyl Oxy Methyl Piperidin 4 One since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... An oligonucleotide corresponding to a target sequence near the smo-1 translational start site (sgRNA #1: 5‘ GCCGATGATGCAGCTCAAGC 3‘) was cloned into the plasmid pMW46 (derivate of pDD162 from Addgene). The deletion of the eleven amino acids ADDAAQAGDNA at the SMO-1 N-terminus was achieved using the oligonucleotide pAF64 as repair template ...
-
bioRxiv - Biochemistry 2022Quote: CRISPR-Cas9-mediated gene ablation was carried out using a guide RNA targeting Cmas exon 4 (5’-TGTCGACGAGGCCGTTTCGC-3’) in the plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid #42230 from Feng Zhang) as used before.11 TSC were cotransfected with GFP-expressing plasmid peGFP-CI (Clontech ...
-
bioRxiv - Neuroscience 2024Quote: ... polyA_R, Table 3) and plasmid backbone (Col1E_F, Col1E_R, Table 4) were amplified from pPRISM-Stop-cmlc2-eGFP (Addgene kit #1000000154; Wierson et al., 2020). The PCR-amplified fragments were assembled using NEBuilder HiFi DNA Assembly Cloning Kit (E5520S ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5’-AAACCCTTATTCGTACGTGGCT-3’) foxl2l#1 and foxl2l#2 fragments were cloned into pT7-gRNA (Addgene) through one-step digestion and ligation respectively ...
-
bioRxiv - Cancer Biology 2021Quote: The Tet-pLKO-puro all-in-one vector (RRID: Addgene_21915) including a puromycin resistance cassette and a tet-responsive element for expression of shRNAs was established according to a publicly available protocol (46 ...
-
bioRxiv - Neuroscience 2022Quote: ... One insert consisted of the U6-sgRNA cassette from Addgene 71236 (gifted from Charles Gersbach [46]) ...
-
bioRxiv - Cell Biology 2024Quote: ... and one of either HIP1R-GFP-FKBP (Addgene Plasmid #100752) or GFP-FKBP-Lca (Addgene Plasmid #59353 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and a second one carrying a landing pad (Addgene #51546) with homology arms (HAs ...
-
bioRxiv - Neuroscience 2021Quote: ... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
bioRxiv - Cell Biology 2020Quote: ... GST-14-3-3 (Plasmid 1942) expression vectors were obtained from Addgene and described 45–46.
-
bioRxiv - Neuroscience 2021Quote: ... (3) AAV8-Syn-ChR2(H134R)-GFP (3×108 g.c.; Addgene #58880-AAV8), and (4 ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3-nitro-tyrosine incorporation plasmid (pAcBac1-3-nitroTyr-A7, Addgene # 141173) was as previously described.35
-
bioRxiv - Neuroscience 2023Quote: ... 1.0 µL of diluted CaMKII.GCaMP6f (AAV1, diluted 1:3 with dPBS or AAV9, diluted 1:10 with dPBS, Addgene number: 100834) was injected in three locations throughout auditory cortex (1.5 mm from lambda ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μg psPAX2 (Addgene), and 3 μg pMD2.G (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 (Addgene plasmid #96963)92 ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μg psPAX2 (Addgene), and 3 μg pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligos 5’ CACCGATCACCCTCTTCGTCGCTT 3’ / 5’ AAACAAGCGACGAAGAGGGTGATC 3’ and 5’ CACCGCTTAGGCCGGAGCGAGCCT 3’/ 5’ AAACAGGCTCGCTCCGGCCTAAGC 3’ were annealed and cloned into the px458 cut with BsaI (Addgene #48138). Plasmids were transfected into cell lines using Genejuice transfection reagent (Merck ...
-
bioRxiv - Neuroscience 2020Quote: ... the target sequence (5’-GGGTGAAGATCCTGTTCAATA-3’) was shuttled to the pLKO.1-Hygromycin vector (Addgene, #24150). For human astrocytes ...
-
bioRxiv - Cell Biology 2023Quote: ... Both pie-1p and pie-1 3’UTR PCR products were amplified using pPK605 plasmid (Addgene) as the template.
-
bioRxiv - Developmental Biology 2023Quote: Transgenic animals were generated by injecting transgenes (15 ng μl-1 each) mixed with a co-injection marker pRF-4 (120 ng μl-1) (Addgene) expressing a dominant negative variant of the rol-6 gene and an empty vector pSK (up to 200 ng μl-1 of DNA ...
-
bioRxiv - Genomics 2022Quote: ... One double-stranded gRNA was cloned into pBFv-U6.2 (Addgene #138400), and the other double-stranded gRNA was cloned into pBFv-U6.2B (Addgene #138401) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the genome editing one vector system (PX459) (104142, Addgene, MA, USA) was used ...
-
bioRxiv - Biophysics 2024Quote: ... and 6 μg of one of the vectors of interest (Addgene #116934 ...
-
bioRxiv - Immunology 2022Quote: ... a 3’ LTR-restored lentiviral expression vector (Addgene #101337, hereafter LV-3’LTR) expressing a GFP reporter was used to express ACE2 or CD169 ...
-
bioRxiv - Cell Biology 2023Quote: ... Most of the genes related with 14-3-3 were acquired from Addgene and cloned into pMX plasmids ...
-
bioRxiv - Plant Biology 2024Quote: ... Acceptors were pOdd1-4 (pCk1-4, Addgene plasmids # 136695-136698) for Level 1 and 3 and pEven1-4 (pCsA-E ...
-
bioRxiv - Developmental Biology 2020Quote: ... targeting the 5’ (5’-AGTGCGCTTCGTCACTGCAC-3’) and 3’ (5’-TCCTCCCGCCCCGACGCGGA-3’) region of the Spen ORF were cloned in the Cas9-GFP pX458 vector (Addgene plasmid #48138). Compatible 5’ and 3’ Homology arms (HA ...
-
bioRxiv - Cancer Biology 2023Quote: SUDHL-4 cell line was infected using pLKO.1-puro-GFP U6 sgRNA (Addgene #50920) containing BAX RNA guides or non-targeting RNA guide:
-
bioRxiv - Physiology 2022Quote: ... or scramble short hairpin RNA (shRNA) (Table 3) was inserted into the plasmid pLKO.1 (8453; Addgene). pSF-lenti or pLKO.1 together with the two helper plasmids psPAX2 (Addgene plasmid 12260 ...
-
bioRxiv - Neuroscience 2024Quote: ... DV: -0.4) and 0.3μl of AAV.PHP.eB-CAG-DIO-tdTomato (28306-PHPeB, Addgene, 1×10¹3 vg/mL) was injected at a rate of 0.05μl/min ...
-
bioRxiv - Cell Biology 2020Quote: ... 5′-CAAACAATCAGCAATGCCTG-3′ and 5′-TGAAGTATTCAGAACAGAAG-3′ and cloned into pX330-P2A-EGFP (Addgene) through ligation using T4 ligase (New England Biolabs) ...
-
bioRxiv - Cell Biology 2020Quote: ... and pET28a(+) (Addgene #69864-3), for His6-tag protein purification ...
-
bioRxiv - Systems Biology 2023Quote: ... and pMW#3 (Addgene #13350) destination vectors using LR Clonase (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2023Quote: - vector pGEX-4T-3 (Addgene_79149) to express only GST protein for alternative screening.
-
bioRxiv - Systems Biology 2024Quote: ... and pMW#3 (Addgene #13350) destination vectors using LR Clonase (ThermoFisher #11791100) ...
-
bioRxiv - Genomics 2021Quote: ... the lentiviral pLKO-Tet-On all-in-one vector68 (Addgene, Watertown, USA) was used ...
-
bioRxiv - Bioengineering 2023Quote: ... and pAAV:CAG-2xNLS-EGFP (equivalent version with one NLS: Addgene ID: 104061), as noted in figures and legends ...
-
bioRxiv - Neuroscience 2023Quote: ... we introduced one of two opsins: AAV1-hSyn1-SIO-stGtACR2-FusionRed (Addgene: 105677-AAV1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... One day after seeding 2000 ng universal donor (pCRISPaint- myc-PuroR, Addgene plasmid # 80961 ...
-
bioRxiv - Neuroscience 2024Quote: ... The he1.1:YFP cassette (he1.1:YFP_F, he1.1:YFP_R, Table 4) was amplified from p3E_he1a:YFP (Addgene, plasmid #113879), and the polyA terminator (polyA_F ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV8-hSyn-DIO-GFP (Addgene, n=8, 4 male, 4 female) were injected bilaterally into the BNST (5 × 1012 titer ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... GFP as non-human target (NHT) control (5’-GGAGCGCACCATCTTCTTCA-3’, 5’-GCCACAAGTTCAGCGTGTC-3’, and 5’-GGGCGAGGAGCTGTTCACCG-3’) cloned into pLentiCRISPRv2 (Addgene, 52961, deposited by Feng Zhang). To generate lentiviral particles ...
-
bioRxiv - Cell Biology 2020Quote: ... was generated by ligating oligonucleotides containing the targeting sequence 5’-CAGTTCCTGGGTGGAGCTA-3’ into pLKO.1-puro (Addgene # 8453). The mitochondrial (CMV-mitoCAR-GECO1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... CASFx-1 (RBFOX1N-dCasRx-C) and CASFx-3 (dCasRx-RBM38) were obtained from Addgene (Plasmid #118635 and #118638). RBFOX1N-dPspCas13b-C was constructed previously 13 ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9; http://n2t.net.addgene:26969; RRID; Addgene:26969 ...
-
bioRxiv - Neuroscience 2022Quote: ... A pcDNA3 flag HA 14-3-3 β plasmid was a gift from William Sellers (Addgene plasmid # 8999 ...
-
bioRxiv - Cell Biology 2023Quote: ... and let-858 3’ UTR and mKate::HA::let-858 3’UTR from pDD287 (Addgene #70685). Correct sequences of constructed plasmids were confirmed with Sanger sequencing ...
-
bioRxiv - Cell Biology 2024Quote: ... The protospacer sequences are: 5′- TCTCCGCTTCTTCCGCCAGT-3′ and 5′-CCTCATCGAGGAAAAACAGG-3′ (cloned into pX459 from Addgene). CRISPRi knockdown cell lines were generated by lentiviral transduction with plasmids containing individual sgRNAs and selected by puromycin at 2 μg/mL ...
-
bioRxiv - Neuroscience 2021Quote: ... one DATcre mouse was injected with AAV8-hSyn-DIO-mCherry (Addgene, cat#50459) in midbrain (SNc ...
-
bioRxiv - Plant Biology 2023Quote: ... in one-step restriction-ligation reactions with a CaMV35sP-ΩTMV (pICH51277; Addgene #50268) and CaMV35sT (pICH41414) ...