Labshake search
Citations for Addgene :
1 - 50 of 2453 citations for 1 Benzyl 3 Tert Butyldimethylsilyl Oxy Methyl Piperidin 4 One since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... human TERT (LOX-TERT-iresTK; Addgene plasmid #12245), generously provided by Didier Trono ...
-
bioRxiv - Cancer Biology 2020Quote: TERT (Addgene plasmid #1771) and a dominant-negative mutant (DN-TERT ...
-
Telomerase deficiency in humans is associated with systemic age-related changes in energy metabolismbioRxiv - Cell Biology 2022Quote: pBABE retroviral vectors on the puromycin-resistant backbone expressing TERT and TERT-HA (Counter et al., 1998) or the empty vector were obtained from Addgene Europe ...
-
bioRxiv - Cell Biology 2024Quote: pBABE retroviral vectors on the puromycin-resistant backbone expressing TERT and TERT-HA (36) or the empty vector were obtained from Addgene Europe ...
-
bioRxiv - Cancer Biology 2020Quote: ... and a dominant-negative mutant (DN-TERT) (Addgene plasmid #1775), and different members of the MIR500 cluster (pre-MIR532 ...
-
bioRxiv - Cell Biology 2024Quote: ... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798; RRID:Addgene_223799 ...
-
bioRxiv - Plant Biology 2024Quote: ... for Level 1 and 3 and pEven1-4 (pCsA-E, Addgene plasmids # 136067-136070) for Level 2 ...
-
bioRxiv - Cell Biology 2024Quote: ... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798 ...
-
bioRxiv - Cancer Biology 2024Quote: WNK1 depletion by CRISPR-Cas9 editing was done by using two independent gRNAs targeting Exon-1 (5’-CGCCGACGCTGTGACCGGC-3’) and Exon-4 (5’-ACTTACACTGGTCACGCGA-3’) cloned into pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W backbone vector (Addgene #67974). TET-ON-Cas9 expressing cells were infected and BFP-positive cell FACS sorted ...
-
bioRxiv - Cell Biology 2024Quote: ... myofibers at differentiation day 3-4 were infected using 1 μl/ml of the AAV9-pAAV.CAG.GCaMP6s.WPRE.SV40 (Addgene viral prep # 100844-AAV9 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Laccase2 Exons 1-3 (Hy_pMT Laccase2 Exons 1-3; Addgene #91799), and nLuc (Hy_pMtnA nLuc SV40 ...
-
bioRxiv - Microbiology 2021Quote: ... 4-363h21C1 and 3-978h1C1 and were cloned into lentiviral vector pLKO.1-puro (Addgene, catalogue #8543). Lentiviral vectors were produced in 293T cells by Fugene transfection and the supernatant was used to infect Jurkat cells ...
-
bioRxiv - Cancer Biology 2021Quote: ... by introducing one or two guide RNAs (5′-GTTGGCTCGCCGGATACGGG-3′ for H3f3b; 5′-ACTCCAGTCTTTCTAGAAGA-3′ for Rosa26) into LentiCRISPR v2 (Addgene plasmid #52961) and LentiCRISPRv2 hygro (Addgene Plasmid #98291) ...
-
bioRxiv - Microbiology 2020Quote: ... targeting ACE2 (5’-TGGATACATTTGGGCAAGTG −3’) and one targeting B4GALT7 (5’-TGACCTGCTCCCTCTCAACG-3’) was cloned into the lentiGuide-Puro plasmid (Addgene plasmid #52963) following published procedure (Sanjana et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798; RRID:Addgene_223799; RRID:Addgene_223800; RRID:Addgene_223801). The protein was expressed in FreeStyleTM HEK293F cells ...
-
bioRxiv - Neuroscience 2023Quote: ... For transfection, 5 µg of DNA (4:3:1 of a transgene, pCMVdR8.74 (packaging plasmid; Addgene, Plasmid #22036) and pMD2.G (envelope plasmid ...
-
bioRxiv - Genetics 2021Quote: ... The TERT-immortalized human melanocyte cell C283T was infected with pCW-Cas9-Blast from Addgene followed by introduction of lentiGuide-Puro (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... TERT+ cells were transiently transfected with human CA-FOXO1 (pcDNA3 Flag-FKHR-AAA mutant; Addgene) (15) ...
-
bioRxiv - Genetics 2024Quote: ... along with 3 µg of pMXs.hOct4 (Octamer-Binding Protein 4, RRID:Addgene_17217), pMXs.hSox2 (SRY-Box Transcription Factor 2 ...
-
bioRxiv - Cell Biology 2024Quote: ... BCL2L13 I224A/L227A/W276A/I279A/I307A/V310A (ΔLIR1+3+4) (RRID:Addgene_223756). After the transformation of the pET-DUET1 vector encoding BCL2L13-GST wild-type or mutants in E ...
-
bioRxiv - Neuroscience 2023Quote: ... muscarinic receptor type 3/1 (CHRM3/1, Addgene) and GFP were co-expressed at a ratio of 8:4:3:1 ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2021Quote: ... For mutagenesis of the two SIMs in sov two pairs of sgRNAs (1+4 and 3+2) were cloned into pCFD4d (Addgene 83954) (Ge et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... U6-1 and U6-3 (Addgene plasmid #83954 ...
-
bioRxiv - Cell Biology 2024Quote: ... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798; RRID:Addgene_223799; RRID:Addgene_223800; RRID:Addgene_223801). The protein was expressed in FreeStyleTM HEK293F cells ...
-
bioRxiv - Cell Biology 2024Quote: ... BCL2L13(I224A/L227A/W276A/I279A/I307A/V310A)-GFP (ΔLIR1+3+4) (RRID:Addgene_ 223784), FUNDC1-GFP (RRID:Addgene_223737) ...
-
bioRxiv - Neuroscience 2023Quote: ... and one of the following helper plasmids: pAAV2/1 (Addgene #112862), pAAV2/2 (Addgene #104963) ...
-
bioRxiv - Cancer Biology 2021Quote: ... two separate NR2F1 guide RNAs (guide 2: 5’-GATCCGCAGGACGACGTGGC-3’ and guide 4: 5’-GGCTGCCGTAGCGCGACGTG-3’) were cloned into pLentiCRISPRv2 (Addgene #52961). A non-targeting (NT ...
-
bioRxiv - Genomics 2023Quote: ... 16 ug of plasmid were prepared for each plate at a ratio of 4:3:1 (sgRNA library: psPAX2(Addgene ID 12259): pMD2G(Addgene ID 12260)) ...
-
bioRxiv - Neuroscience 2022Quote: ... +0.4 ML with diluted (1:3; Addgene) 4 × 0.15 μL of AAV9-Synapsin-jGCaMP7f-WPRE (Addgene) ...
-
bioRxiv - Developmental Biology 2023Quote: ... lentiviral supernatants were generated by transfecting one 10-cm plate of HEK-293T cells at 90% confluency with 3 µg pMD2.G (Addgene #12259), 9 µg psPAX2 (Addgene #12260) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and g2 (5’- CCATGTATGGGGTCACAGCCTCTGCTAGGACCAAGCCAAGACCATCTGCTGTCACAACCACTGC ACACCTGG-3’) and cloned these guides into the All-in-one (AIO)-PURO vector encoding the Cas9D10A nickase (Addgene #74630). U2OS cells were treated with 2 µg/mL of puromycin (Invitrogen ...
-
bioRxiv - Bioengineering 2022Quote: ... we generated one plasmid harboring 4 distinct sgRNAs targeting the promoter region of AaRel1 (AAEL007696, OA-1127B, Addgene plasmid #190997). Firstly ...
-
bioRxiv - Neuroscience 2022Quote: ... (4) P10-3’UTR was amplified from pJFRC81-10XUAS-IVS-Syn21-GFP-p10 (Addgene 36432); (5 ...
-
bioRxiv - Cancer Biology 2021Quote: ... TERT+ cells were transiently transfected with human CA-FOXO1 (pcDNA3 Flag FKHR AAA mutant; gift from Kunliang Guan; Addgene plasmid # 13508) using polyethyleneimine ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary fibroblasts were immortalized with 293FT (Invitrogen)-derived supernatant containing a human telomerase reverse transcriptase (TERT) lentivirus that was generated with the plasmids pLV-hTERT-IRES-hygro (gift from Tobias Meyer; Addgene #85140)(24) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The two configurations that enabled efficient packaging of full-length vector genomes (designs 1 and 4) are available on Addgene (pEJS1099: Dual-sgRNA:Design 4, Addgene #159537; pEJS1096: Dual-sgRNA:Design 1, Addgene # 159538). Oligonucleotides with spacer sequences for target genes were inserted into the sgRNA cassette by ligation into the BspQI and BsmBI cloning sites.
-
bioRxiv - Genetics 2022Quote: ... were cloned into pCFD4-U6:1-U6:3 (Addgene® plasmid #49411 ...
-
bioRxiv - Biochemistry 2024Quote: ... two all-in-one CRISPR-Cas9 vectors were generated from pX330A-1×2 (58766, Addgene) and pX330S-2-PITCh (63670 ...
-
bioRxiv - Microbiology 2023Quote: ... 6 µg of 4:2:1:1 transfer:Gag-Pol (pMDLg-pRRE, Addgene):Rev (pRSV-Rev ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9 ...
-
bioRxiv - Neuroscience 2024Quote: ... groups of 3-4 pups were separated from their mother and 6 µl of AAV9.CAG.GCaMP6s.WPRE.SV40 (Addgene, USA) was injected subcutaneously in the nape of the neck ...
-
bioRxiv - Cancer Biology 2020Quote: ... and pRSV-Rev (at a ratio of 4:1:1:1, Addgene#12259, #12251, #12253)41 into HEK293T cells ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1 μg pCXLE-hOCT3/4-shP53 (Addgene #27077) and electroporated using the Neon System (Invitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: ... one expressing Cas9 (Addgene # 52962-LV)16 and one expressing dCas9-KREB (Addgene # 89567)17 ...
-
bioRxiv - Microbiology 2023Quote: ... One copy of mKate2 (Addgene #68441) was fused to a strong promoter from the Anderson collection (Table 2 ...
-
bioRxiv - Neuroscience 2023Quote: ... one plasmid (px458, Addgene Plasmid #48138) expressing sgRNA as well as Cas9 was used to introduce double-strand-breaks near Exon 7 of SMN2 locus ...
-
Synchronous 3D patterning of diverse CNS progenitors generates motor neurons of broad axial identitybioRxiv - Neuroscience 2024Quote: ... one plasmid (px458, Addgene Plasmid #48138) expressing sgRNA as well as Cas9 was used to generate pTG-Cr- ISL1 and to introduce double-strand breaks near the stop codon of Exon 6 of Islet1 locus ...
-
bioRxiv - Developmental Biology 2024Quote: ... one packaging plasmid (psPAX2, Addgene: #12260) and one envelope plasmid (pVSVG ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...