Labshake search
Citations for Addgene :
451 - 500 of 2453 citations for 1 Benzyl 3 Tert Butyldimethylsilyl Oxy Methyl Piperidin 4 One since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... an Fmr1 exon 3 DNA oligonucleotide was inserted into pLentiCRISPR (Addgene, 49535) adapted from published methods [12] ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Isoform 3 constructs were cloned into a pMSCV puro backbone (Addgene) and packaged into retrovirus using Phoenix-AMPHO producer cells (ATCC) ...
-
bioRxiv - Genetics 2022Quote: ... 500 ng/ul pBac[3xP3-EGFP;Tc’hsp5’-Gal4Delta-3’UTR] (Addgene #86449), 80 ng/ul Of-v gRNA described above (see “CRISPR/Cas9 mutagenesis of Of-vermilion”) ...
-
bioRxiv - Cell Biology 2023Quote: ... 3) pMXs-IP-EGFP-mATG5 was a gift from Noboru Mizushima (Addgene plasmid #38196 ...
-
bioRxiv - Cancer Biology 2023Quote: PC-3 cells were transfected with Emerin-pEGFP-C1 (Addgene plasmid #61993). Forty-eight hours post-transfection cells were cultured in medium containing G-418 (400Lμg/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV8-hSyn-EGFP (1μL per site, titer ≥ 3 ×1012 vg/mL, Addgene) was injected bilaterally in the dHP ...
-
bioRxiv - Cell Biology 2024Quote: ... co-injection marker pCFJ104 (Pmyo-3-mCherry; Addgene #19328, 5 ng/µL) and marker pCFJ90 (Pmyo-2-mCherry ...
-
bioRxiv - Neuroscience 2020Quote: [4] T2A-GCaMP6s from pGP-CMV-GCaMP6s (Addgene plasmid #40753) with T2A sequence includedintheforwardprimer(underlined ...
-
bioRxiv - Neuroscience 2020Quote: ... two unc-4 sgRNA plasmids and Cas9 plasmid (Addgene #46168) (Friedland et al. ...
-
bioRxiv - Molecular Biology 2020Quote: Mouse GFP-PGC-1α full length (FL) plasmid (Addgene, #4) was used as template for PCR amplification of a delta C-terminal domain (ΔCTD ...
-
bioRxiv - Immunology 2022Quote: ... Cells were transfected with 4 mg of SNAP-CD59 (Addgene) using Lipofectamine 3000 (Life Technologies) ...
-
bioRxiv - Genomics 2022Quote: ... 4 µg of the envelope-encoding plasmid pVSVg (Addgene 12260) and 7.5 µg of the packaging plasmid psPAX2 (Addgene 8454 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 4 μg of envelope plasmid (pMD2.G; Addgene #12259) with 112 μg PEI MAX (Polysciences ...
-
bioRxiv - Cell Biology 2023Quote: ... and 4 µg of the viral packing PsPAX (Addgene #12260) plasmids using the Polyfect reagent according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 µg sgRNAb/Cas9 plasmid (Addgene 62988, Supplementary table 6), 200 µl Opti-Mem and 25 µl Lipofectamine 2000 was prepared ...
-
bioRxiv - Cell Biology 2022Quote: ... Tau fragments were subcloned into pcDNA3.1 by restriction digestion and further into pCW57.1- MAT2A all-in-one tet-off lentiviral backbone (a gift from David Sabatini (Addgene plasmid # 100521))71 by Gibson assembly ...
-
bioRxiv - Molecular Biology 2022Quote: U-2 OS CRISPR knockout lines were generated using the All-in-One plasmid encoding dual sgRNAs and fluorescent protein-coupled Cas9D10A nickase (AIO-GFP; Addgene #74119) (Chiang et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRNAs were synthesized and subcloned into the BsmBI site of the all-in-one (dox-inducible Cas9-2A-eGFP and constitutive U6 promoter) TLCV2 vector (Addgene #87360). sAC-targeted sgRNAs ...
-
bioRxiv - Cancer Biology 2022Quote: ... and DNMT3B shRNAs were cloned into Tet-ON all- in-one plasmids LT3GEPIR (gift from Johannes Zuber, Addgene Plasmid #111177, RRID:Addgene_111177) and LT3REPIR (same as LT3GEPIR except for GFP being substituted with dsRed ...
-
bioRxiv - Physiology 2020Quote: ... Mice were injected in each side or one side of the DMH with ∼0.5 µL AAV2-hSyn-DIO-hM3D(Gq)-mCherry (Addgene, Cambridge, USA), AAV2-hSyn-DIO-hM4D(Gi)-mCherry (Addgene) ...
-
bioRxiv - Genetics 2020Quote: ... All-in-one-plasmids encoding both Cas9 and the desired sgRNA were created by site-directed mutagenesis of pDD162 (Addgene #47549) (Dickinson et al ...
-
bioRxiv - Cell Biology 2022Quote: ... the same procedure was conducted to create and quantify the one-vector format Brunello human CRISPR knockout pooled library (Addgene #73179,59).
-
bioRxiv - Microbiology 2022Quote: ... insertion of was performed by ClonExpress II One Step Cloning Kit (Vazyme, China) with SpeI-digested pENTR4-FnCas12a and TetR amplicon of plasmid pFREE vector (Addgene, #92050) with the primer pair Tet-F3/Tet-R3 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... An all-in-one Cas9/gRNA expression construct by cloning an AAVS1 sgRNA sequence derived from pCas9-sgAAVS1-2 PX458 (Addgene #129727) downstream of the hU6 promoter in a PX458 (Addgene #48138 ...
-
bioRxiv - Developmental Biology 2022Quote: ... guide RNA targeting the first exon of the mouse NHE1 gene was designed and cloned into an all-in-one doxycycline (Dox)-inducible vector TLCV2 (Addgene #87360). In brief ...
-
bioRxiv - Neuroscience 2023Quote: The all-in-one gRNA-Cas9 expression plasmid used for CRISPRa was generated by modifying the hUBC-dSpCas9-2xVP64-T2A-BSD plasmid (Addgene #162333) to remove the T2A-BSD selection marker and include a U6-gRNA scaffold ...
-
bioRxiv - Cell Biology 2023Quote: ... Each of the following plasmids (15 µg) was added to one 15-cm dish: ASCL1 (TetO-ASCL1-puro, Addgene plasmid # 97329), DXL2 (TetO-DXL2-hygro ...
-
bioRxiv - Bioengineering 2024Quote: An all-in-one Cas9/gRNA expression construct encoding an AAVS1 sgRNA sequence derived from pCas9-sgAAVS1-2 PX458 (Addgene; 129727) was placed downstream of the hU6 promoter in a PX458 (Addgene ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The previously described GIRK1-F137S hometetramerization mutant 63 was used for patch clamp recordings and the ONE-Go Gαi3 biosensor (Addgene kit #1000000224) was used for BRET measurements ...
-
bioRxiv - Cancer Biology 2024Quote: ... heterozygous AQR and BRCA2 3308 mutation cell lines MCF10A iCas9 cells were transfected with an all-in-one pSpCas9(BB)-2A-GFP plasmid (PX458, Addgene 48138), containing a CRISPR guide sequence targeting TP53 exon 2 (TCGACGCTAGGATCTGACTG) ...
-
bioRxiv - Developmental Biology 2024Quote: ... DICE system was introduced into the H11 locus of NKX2-5eGFP/w using 2 plasmids: one carrying Cas9 nuclease and two guide RNAs (Addgene#164850) and a second one carrying a landing pad (Addgene #51546 ...
-
bioRxiv - Cell Biology 2022Quote: ... plasmid (TLCV2-ApaLI(*)-T2A-mTagBFP2-Puro) used in all other figures were cloned using the all-in-one Dox-inducible lentiviral backbone of TLCV2 (Addgene Plasmid #97360) by inserting mito-ApaLI(* ...
-
bioRxiv - Biochemistry 2023Quote: ... fluorophore labelled ‘601’ DNA was generated using large-scale PCR with Phusion polymerase (produced in-house) from a pGEM- 3z/601 plasmid containing one copy of ‘601’ DNA (gift from J. Widom, Addgene plasmid #26656)(Lowary & Widom ...
-
bioRxiv - Microbiology 2022Quote: ... pLenti-X2-Zeo-DEST (749-3) [a gift from Eric Campeau (Addgene, 21562)] and the donor vector ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgFLI_Ex9 (5’-GCCTCACGGCGTGCAGGAAG-3’) was cloned into lentiCRISPR v2-Blast vector (Addgene, #83480) using BsmbI restriction sites ...
-
bioRxiv - Cell Biology 2020Quote: ... pDD162 (Peft-3::Cas9 + Empty sgRNA) was a gift from Bob Goldstein (Addgene plasmid # 47549 ...
-
bioRxiv - Biophysics 2020Quote: ... and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907) with Lipofectamine 2000 according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... a p21 sgRNA (5’-GATTGCGATGCGCTCATGGC-3’) was cloned into the px330 vector (Addgene). ESCs were co-transfected with 2μg of this vector and 0,12μg of an hygromycin marker (#631625 ...
-
bioRxiv - Biochemistry 2021Quote: ... The pcDNA 3-CDK9 HA plasmid was purchased from Addgene (ID 14640, RRID:Addgene_14640), which was originally established by Dr Matija Peterlin (43) ...
-
bioRxiv - Neuroscience 2022Quote: ... unique sgRNA (5’-CACCGGGACATAGTATTTGAAAGAC-3’) was cloned into lenti-CRISPRv2 construct (Addgene #52961), which expresses Cas9 and puromycin cassette ...
-
bioRxiv - Neuroscience 2022Quote: A viral cocktail containing AAV2/5.GfaABC1D GCaMP6f (3 × 1012 gc/ml, Addgene) for astrocyte Ca2+ detection or AAV9.hSyn.GCaMP6f (3 × 1012 gc/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... pDD162 (Peft-3::Cas9 + Empty sgRNA) was a gift from Bob Goldstein (Addgene plasmid # 47549 ...
-
bioRxiv - Cell Biology 2021Quote: ... the Cas9-expression plasmid pDD162 (Peft-3::Cas9, 50 ng/μL, Addgene #47549) (Dickinson et al. ...
-
bioRxiv - Immunology 2021Quote: ... pLenti-GFP (Core with 5’ and 3’ LTR) was also from Addgene (#17448) and the plasmids containing Tat1b and Rev1b (SARS-Related Coronavirus 2 ...
-
bioRxiv - Genetics 2021Quote: ... and 3 μg of each paired TALEN targeting either AAVS1 or CLYBL (Addgene, 59025/59026 or 62196/62197 ...
-
bioRxiv - Cancer Biology 2022Quote: ... PC-3 cells were transduced with lentivirus containing lentiCas9-Blast construct (Addgene #52962) and selected with growth medium containing 4 µg/ml blasticidin for approximately one week ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-mDlx-ChR2-mCherry-Fishell-3 was a gift from Gordon Fishell (Addgene plasmid # 83898 ...
-
bioRxiv - Neuroscience 2024Quote: ... we bilaterally injected with RetroAAV-hSyn-Cre (500nL, Addgene Lot v70508, 3*1013) into the LS ...
-
bioRxiv - Neuroscience 2024Quote: ... 750 nl of the retroAAV-hsyn-Cre (500nL, Addgene Lot v70508, 3*1013) was injected in the VTA of male and female C57/BL6 mice ...
-
bioRxiv - Developmental Biology 2023Quote: ... Bot oligo – 5’-aaacTTGGCACTCCATTAGATCCG-3’) were cloned into U6.3>gRNA.f+e (#99139, Addgene) and electroporated at a concentration of 1.5 ug/ul ...