Labshake search
Citations for Addgene :
1401 - 1450 of 1574 citations for Mouse Anti Human Papilloma virus type 18 718 238 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... a total of 240 million Huh7.5.1-Cas9-blast or Huh7.5.1-Cas9-blast+ACE2-IRES-TMPRSS2-hygro cells were transduced with lentivirus of the human GeCKO v2 library (Addgene, #1000000049, gift from Feng Zhang) at a moi of 0.4 and subsequently selected using puromycin and expanded for 7 days ...
-
bioRxiv - Physiology 2020Quote: The human codon-optimized Cas9 and chimeric guide RNA expression plasmid (pX459v2) developed by the Zhang lab were obtained from Addgene (Cong et al., 2013). To generate gRNA plasmids ...
-
bioRxiv - Molecular Biology 2021Quote: ... The plasmid for tagging the N-terminus of the human lamin B1 gene (LMNB1) with RFP was purchased from Addgene (LMNB1-mTagRFP-T, #114403). The plasmid sequence was validated by Sanger sequencing.
-
bioRxiv - Microbiology 2022Quote: ... Dimeric human ACE2-IgG1 (hACE2) was generated by transfecting Expi293 cells with pcDNA3-sACE2-WT(732)-IgG129 (Addgene plasmid #154104, gift from Erik Procko) using 1 mg mL-1 PEI and then purifying from the supernatant five days post-transfection using rProtein A Sepharose (GE ...
-
bioRxiv - Neuroscience 2022Quote: ... the truncated human astrocyte-specific promoter hGfaABC1D (54) was digested from pAAV-GFAP-EGFP (donated by Dr. Bryan Roth, Addgene Plasmid #50473; RRID #Addgene_50473) and cloned into pAAV-EF1a-DIO-hM4D(Gi)-mCherry (donated by Dr ...
-
bioRxiv - Developmental Biology 2020Quote: Mouse YAP cDNAs were isolated by PCR amplification using DNA templates obtained from Addgene (Watertown, MA) and cloned into a shuttle vector at Creative-Biogene (Shirley ...
-
bioRxiv - Molecular Biology 2020Quote: CRISPR–Cas9 screen was performed using genome-scale mouse Brie CRISPR knockout pooled library (Addgene #73633) 68 ...
-
bioRxiv - Immunology 2020Quote: ... we first amplified sgRNA sequences from an optimized mouse CRISPR knockout library lentiCRISPRv2-Brie (Addgene #73632). A total of eight 50 μL PCR reactions were performed to maximize coverage of sgRNA complexity ...
-
bioRxiv - Developmental Biology 2019Quote: ... MEFs were transduced with the doxycycline-inducible mouse tet-STEMCCA [27] and rtTA lentiviruses (Addgene # 20342) at an MOI of 1 ...
-
bioRxiv - Molecular Biology 2021Quote: Mouse FLAG-Sp7 or osteocrin cDNAs were introduced via lentivirus via pLX_311 backbone (Addgene, plasmid 118018) as previously described [21] ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mouse Improved Genome-wide Knockout CRISPR Library v2 was a gift from Kosuke Yusa (Addgene #67988) (Tzelepis et al ...
-
bioRxiv - Molecular Biology 2021Quote: Notch1 and Jagged1 constructs were generated by polymerase chain reaction (PCR) using mouse Notch1 (Addgene 41728), human Notch1 (kind gift of Dr ...
-
bioRxiv - Cell Biology 2023Quote: ... Expression vectors for mouse PDGFRα and PDGFRβ were generated from pcDNA5FRT-EF-Pdgfra-EGFPN (Addgene #66787) and pcDNA5FRT-EF-Pdgfrb-EGFPN (Addgene #66787) ...
-
bioRxiv - Cell Biology 2023Quote: Mouse HA-Sox9-P2A and P2A-Cre blocks were PCR-amplified from pWPXL-Sox9 (Addgene, #36979) and AAV:ITR-U6-sgRNA(backbone)-TBG-Cre-WPRE-hGHpA-ITR(Katsuda et al. ...
-
bioRxiv - Cell Biology 2023Quote: Mouse HA-Sox4-P2A and P2A-Cre blocks were PCR-amplified from pLVXT-Sox4 (Addgene, #101121) and AAV:ITR-U6-sgRNA(backbone)-TBG-Cre-WPRE-hGHpA-ITR31 respectively ...
-
bioRxiv - Biochemistry 2023Quote: ... Mouse H2A.Z.1 gene in pIND-EGFP was a kind gift from from Danny Rangasamy (Addgene plasmid # 15770 ...
-
bioRxiv - Immunology 2023Quote: ... mouse naïve CD4+ T cells were transfected with p8xEGFP-N1 (Addgene # 122168, gift from Georg Mayr) which expresses 8 concatemeric EGFP proteins ...
-
bioRxiv - Molecular Biology 2024Quote: ... The sensing domain for cAMP comprised residues of 199–358 of mouse Epac1 (Addgene plasmid #73938). The sensing domain for citrate comprised residues 4–133 of the CitAP domain from Klebsiella pneumoniae CitA protein (Addgene plasmid #134301) ...
-
bioRxiv - Cell Biology 2021Quote: ... .The KIF1C motor domain was replaced with full length human KIF1C fused to mCherry from pKIF1C-mCherry (available from Addgene 130978 (Theisen et al., 2012)) using NheI and BsrGI ...
-
bioRxiv - Microbiology 2020Quote: ... a total of 300 million Huh7.5.1-Cas9 cells were then separately transduced with the lentiviral gRNA sublibraries A and B of the human GeCKO v2 library (Addgene #1000000049, gift from Feng Zhang) at a multiplicity of infection (MOI ...
-
bioRxiv - Biochemistry 2021Quote: The RAS binding domain of C-RAF kinase (RAF-RBD) (Brtva et al., 1995) and full-length human RASSF5 from the RAS clone collection were obtained from Addgene (Raf1-RBD: #13338, RASSF5: #70545). The RAS clone collection was a gift from Dominic Esposito (Addgene kit 1000000070) ...
-
bioRxiv - Cell Biology 2024Quote: ... N-terminal FLAG-tagged CAPS was created by recombining the human CAPS gene (CAPS/pENTR; DNAsu HscD00514950) into pEZFLAG (Addgene#18700; Guo et al., 2008) using Gateway cloning ...
-
bioRxiv - Cell Biology 2023Quote: The sequences encoding STIM1 and RspA-NFAST were amplified by PCR from respectively the human STIM1-YFP plasmid (Addgene #19754, a gift from A. Rao) and the pAG573 FRB-RspA(N)-IRES-mTurquoise214 plasmid ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... GFP as non-human target (NHT) control (5’-GGAGCGCACCATCTTCTTCA-3’, 5’-GCCACAAGTTCAGCGTGTC-3’, and 5’-GGGCGAGGAGCTGTTCACCG-3’) cloned into pLentiCRISPRv2 (Addgene, 52961, deposited by Feng Zhang). To generate lentiviral particles ...
-
bioRxiv - Biophysics 2024Quote: ... the DNA fragments of human TDP-43 obtained from the TDP-43 expression plasmid as previously reported 45 and G3BP1 from Addgene (Clone#129339, Watertown, MA, USA) were inserted into the HindIII and BamHI sites of pcDNA-SNR (pTDP43-SNR and pG3BP1-SNR ...
-
bioRxiv - Cell Biology 2022Quote: 6.0 × 10^6 BJAB clone B2 cells expressing both Cas9 and ERAAP dsRed were transduced with lentivirus of human GeCKO v2 library (Addgene, #1000000049, gift from Feng Zhang) at an MOI of 0.4 using spin-infection (1,000 g for 2 h at 33 °C) ...
-
bioRxiv - Systems Biology 2022Quote: ... a total of 240 million A549-Cas9 cells were transduced with the lentivirus of the human GeCKO v2 library (Addgene #1000000049, gift from Feng Zhang) (48 ...
-
bioRxiv - Microbiology 2020Quote: ... the mouse cDNA sequence of IRE1 from MEF cells was inserted into pcDNA3- EGFP plasmid (Addgene #13031), resulting in fusion proteins with the EGFP fused to the carboxy terminus of IRE1 ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse Neurexin3α-(-S4) (cDNA gift from Ann Marie Craig’s lab) and rat Neurexin3β-(-S4) (cDNA from Addgene plasmid #58269 from Peter Scheiffele’s lab) ...
-
bioRxiv - Developmental Biology 2019Quote: SAM mouse embryonic stem cells (ESCs) were generated by lentiviral transduction of lenti dCas9-VP64_Blast (Addgene 61425) and lenti MS2-p65-HSF1_Hygro (Addgene 61426 ...
-
bioRxiv - Systems Biology 2019Quote: ... and Dnmt3L KI cells were transduced with the Mouse CRISPR Knockout Pooled Library (GeCKO v2) (Addgene, # 1000000052) [48] via spinfection as previously described ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse SMO (gift from Gregory Pazour, UMass, Worcester, USA; plasmid no. 164532; Addgene (Desai et al., 2020)) ...
-
bioRxiv - Immunology 2022Quote: ... Mouse Brie CRISPR knockout pooled library was a gift from David Root and John Doench (Addgene #73633). The plasmid DNA pool was amplified as previously described (Doench et al ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... We utilized a well-functioning and validate genome-wide mouse lentiviral CRISPR guide RNA library v2 (Addgene). It consists of 90230 gRNA sequences directed against 18424 different genes across the mouse genome ...
-
bioRxiv - Microbiology 2022Quote: Mouse Brie CRISPR knockout pooled library was a gift from David Root and John Doench (Addgene #73633) (42 ...
-
bioRxiv - Immunology 2023Quote: Mouse naïve CD4+ T cells were transfected with C1-MPAct-mCherry (Addgene #155222, gift from Tobias Meyer) and C1-eGFP-CaaX (Addgene #86056 ...
-
bioRxiv - Cell Biology 2024Quote: ... mGreenLantern4 sequence and mouse Rab4A sequence (CCDS52703.1) were synthesized and cloned into a pT4 (Addgene#108352, RRID:Addgene_108352)-based Sleeping Beauty gene expression vector ...
-
bioRxiv - Cell Biology 2024Quote: ... mGreenLantern4 sequence and mouse Rab4A sequence (CCDS52703.1) were synthesized and cloned into a pT4 (Addgene#108352, RRID:Addgene_108352)-based Sleeping Beauty gene expression vector ...
-
bioRxiv - Cancer Biology 2023Quote: ... and a recoded human L1 sequence (encoding both ORF1 and ORF2) cloned from the L1-neo-TET plasmid (Addgene # 51284; a gift from Astrid Roy-Engel)(PubMed 19390602) ...
-
bioRxiv - Immunology 2023Quote: ... Variable regions were cloned into pVITRO1 plasmids that already contained the constant regions for human IgG1 heavy and light chains (κ or λ, Addgene plasmids #61883 and #50366)85 using Gibson Assembly75 ...
-
bioRxiv - Neuroscience 2024Quote: ... a 448 bp human synapsin-1 promoter element driving the neuronal specific expression of 4) the fluorescent protein mTagBFP2 (Addgene plasmid #191566 pLKO.1-TRC mTagBFP2) fused to the plasma membrane targeting sequence CAAX2 (Addgene plasmid #162247 ...
-
bioRxiv - Cancer Biology 2019Quote: ... The mouse Sik3 cDNA purchased from GE Dharmacon (Clone ID: 6515742) was cloned into a LentiV_Neo vector (Addgene_108101) using In-Fusion cloning system (Clontech) ...
-
bioRxiv - Immunology 2021Quote: The mouse BRIE knockout CRISPR pooled library was a gift of David Root and John Doench (Addgene #73633) (36) ...
-
bioRxiv - Neuroscience 2020Quote: ... Mouse nAChR alpha4 CFP was a gift from Henry Lester (Addgene plasmid # 15244; http://n2t.net/addgene:15244; RRID:Addgene_15244). Human α3-nAChR-GFP was obtained from Sino Biological (HG29719-ACG) ...
-
bioRxiv - Immunology 2020Quote: The mouse BRIE knockout CRISPR pooled library was a gift of David Root and John Doench (Addgene #73633) (36) ...
-
bioRxiv - Cell Biology 2022Quote: ... a gRNA targeting exon three of mouse TOM1L2 (GCTCTAAAGAAGCGGCTTAG) was cloned into pX459V2.0-eSpCas9(1.1) (gift from Yuichiro Miyaoka; Addgene; plasmid no ...
-
bioRxiv - Neuroscience 2022Quote: ... the Adamts2 or TGFβR2 coding sequence was amplified by PCR using mouse Adamts2 and TGFβR2 ORF plasmids (pCMV-Adamts2, Harvard plasmid clones; pCMV-TGFβR2, Addgene) as templates ...
-
bioRxiv - Neuroscience 2022Quote: ... and one CaMKII mouse was infused with AAV9-synapsin-SomArchon-GFP (titer: 5.9×1012 GC/mL, Addgene #126941). PV mice (n=9 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genetic depletion of mouse RhoA or AKT1 in vivo was conducted using pSECC (#60820; Addgene, Watertown, MA, USA), a lentiviral-based system that combined both the CRISPR system and Cre recombinase ...
-
bioRxiv - Cancer Biology 2023Quote: ... male mice were injected with 6.4 X 108 GC/mouse of AAV8.TBG.PI.Cre.rBG (AAV-TBG-Cre, Addgene, 107787-AAV8) diluted in 100μL PBS via the tail vein ...