Labshake search
Citations for Addgene :
1251 - 1300 of 1574 citations for Mouse Anti Human Papilloma virus type 18 718 238 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... pCDNA3-mouse PKA-RIalpha-mEGFP (Addgene plasmid # 45525; http://n2t.net/addgene:45525; RRID:Addgene_45525), pcDNA3-mouse PKA-RIbeta-mEGFP (Addgene plasmid # 45526 ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3-mouse PKA-RIbeta-mEGFP (Addgene plasmid # 45526; http://n2t.net/addgene:45526; RRID:Addgene_45526), and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527 ...
-
bioRxiv - Genetics 2023Quote: ... Codon-optimized of full-length mouse RNF212B was cloned into pET-28b (+) (Addgene) with a C-terminal 6xHis tag ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mouse ULK1 cDNA was isolated from a p3xFLAG-CMV14-mULK1 vector (#24301, Addgene) by PCR and cloned into the Halo-tagged pFN21A vector (Promega ...
-
bioRxiv - Microbiology 2023Quote: The Mouse Genome-wide Knockout CRISPR sgRNA Library was purchased from Addgene (#67988)5 ...
-
bioRxiv - Neuroscience 2024Quote: ... pCAG_MMP-9 – full length mouse (MMP-9) from pcDNA3.1_MMP-9-HA (Addgene #121172) cloned into pCAG vector ...
-
bioRxiv - Neuroscience 2024Quote: ... Recombinant mouse myc-netrin-1 was cloned into pSBI-GN vector (Addgene, 60517) to prepare a stable HEK293 cell line expressing mouse netrin-1.
-
bioRxiv - Cell Biology 2020Quote: Plasmid YFP-SRI was generated by sub-cloning human sorcin cDNA taken from pAd-hSRI (22) into KpnI-ApaI sites of mVenusC1 (Addgene #27794).
-
bioRxiv - Molecular Biology 2020Quote: FLAG-mEm-WT Tau and FLAG-mEm-Tau K174Q sequences were cloned into pAAV2 vector under human synapsin promoter (Addgene, #50465). Adenoviral particles were used to infect a primary hippocampal culture.
-
bioRxiv - Molecular Biology 2021Quote: ... similar to how we previously generated the human cell expression constructs for AcrIIA4 and AcrIIA5 (Addgene IDs 133801 and 133802, respectively) (see Supplementary Sequences) ...
-
bioRxiv - Cell Biology 2022Quote: ... and Δ50 were PCR amplified from human templates using forward (fwd) primer 1593 and reverse (rev) primer 1651 and inserted into mycBioID2 pBabe puro (Addgene #80901) cut EcoRI to PmeI ...
-
bioRxiv - Genetics 2019Quote: sgRNAs targeting human ADCK4 (sgRNA1: GCTGCACAATCCGCTCGGCAT, sgRNA2: GTAAGGTCTGCACAATCCGCT, and sgRNA3: GACCTTATGTACAGTTCGAG,) were cloned into BsmBI-digested lentiCRISPR v2 (Addgene plasmid #52961). ADCK4 cDNA was cloned into the p3xFLAG CMV26 (C-terminal ...
-
bioRxiv - Neuroscience 2020Quote: ... was cloned into a rAAV vector under the human synapsin promoter using the plasmid pAAV-hSyn-EGFP (gift from Bryan Roth; Addgene, #50465) as backbone and removing EGFP ...
-
bioRxiv - Neuroscience 2020Quote: UAS-SMARCA1 construct: Flies carrying UAS-SMARCA1WT were generated using human SMARCA1 cloned into the pFastBac Dual vector (Addgene plasmid #102243). Gateway cloning (Invitrogen ...
-
bioRxiv - Bioengineering 2020Quote: A pair of guide RNA targeting human EGFR was cloned into pSpCas9(BB)-2A-GFP (px458) plasmid vector (Addgene plasmid #48137) (Addgene ...
-
bioRxiv - Biophysics 2021Quote: ... Fractions containing the target proteins were dialyzed against PBS (pH 7.4) and the His6-SUMO-tag was removed by enzymatic cleavage using human SENP1 protease at 4°C overnight (Addgene #16356) (51) ...
-
bioRxiv - Cell Biology 2021Quote: ... The human MISP and EGFP-MISP sequences were subcloned into modified pFastBac-6xHis-MBP plasmid LIC expression vector (Addgene; plasmid #30116). All constructs were confirmed by sequencing.
-
bioRxiv - Neuroscience 2020Quote: ... with a pEGFP-C1 mammalian vector containing full length human A53T variant αSyn with a fusion EGFP tag (Addgene, Plasmid #40823), following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... uracil glycosylase inhibitor (UGI) and 3’UTR of human ATP5B was amplified from the published DdCBE construct (Addgene plasmid no. 157843). The PCR product was digested with the restriction enzymes XbaI and EcoRI ...
-
bioRxiv - Biochemistry 2020Quote: Human ATAD2/B cDNA (UniProt codes Q9ULIO and Q6PL18) was a gift from Nicole Burgess-Brown (Addgene plasmid # 38916 and 39046)7 ...
-
bioRxiv - Microbiology 2020Quote: ... A CRISPR/Cas9 lentiviral vector against human-β2 microglobulin was constructed by cloning an expression cassette for both Cas9 and guide RNA (gRNA) of PX458 (Addgene #48138) into the FG12 vector ...
-
bioRxiv - Cell Biology 2021Quote: ... The coding sequence for human Dia1 was purchased from GeneScript and cloned in eBFP2-N1 backbone vector (gift from Michael Davidson, Addgene #54595) using XhoI/Kpn1 double digestion ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293T cells seeded to 150mm dishes were transfected with 21 μg of the human gRNA pooled library in lentiGuide-Puro (Addgene #1000000049), 15.75 μg of pSPAX2 and 5.25 μg of pVSV-G plasmids ...
-
bioRxiv - Biochemistry 2022Quote: ... Full-length human KRAS4B G12C was ectopically expressed from the retroviral expression vector pBABE containing an N-terminal HA-tag (Addgene #58901). Viral particles were generated by transient transfection of each expression vector into HEK 293T cells using Fugene6 (Promega ...
-
bioRxiv - Cancer Biology 2022Quote: ... These cells were then infected with an inducible Tet-ON lentivirus carrying the human PLK1 cDNA (pLenti CMVtight Hygro DEST from Addgene #26433) and selected with hygromycin (350 µg/ml) ...
-
bioRxiv - Cancer Biology 2022Quote: ... carrying the human CRISPR KO pooled library Brunello in a lentiGuide-Puro backbone (gift from David Root and John Doench; Addgene #73178) to a final volume of 2 mL with 4 µg/mL polybrene ...
-
bioRxiv - Immunology 2020Quote: ... Human orfeome clone 10217) was gateway cloned into an attR-destination vector encoding an N-terminal FLAG tag (Addgene, Plasmid #18700), with the Gateway™ LR Clonase™ II Enzyme mix (ThermoFisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tetracycline-inducible TET-shRB1 and constitutive shRB1 constructs were created by integrating validated siRNA sequences GAAAGGACATGTGAACTTA (63) and GAACGATTATCCATTCAAA (64) targeting human RB1 (shRB1) into TET-pLKO.1-Puro vector (Addgene #21915) and pLKO.1-Puro vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... plasmids were created by integrating validated siRNA sequences CCTGTCAGGAAACTGTATGAT (62) and AATGGCCATCAGAACGGACTT targeting human ESRRG (shESRRG) into pLKO.1-Puro vector (Addgene #8453). Non-specific siRNA sequence AACAGCCACAACGTCTATATC or siRNA sequence CAACAGCCACAACGTCTATAT targeting GFP were used as controls for shRNA ...
-
bioRxiv - Microbiology 2021Quote: ... The oligos of CRISPRa library were synthesized in Synbio Technologies according to the Human Genome-wide CRISPRa-v2 Libraries (Addgene, 83978) (30).
-
bioRxiv - Neuroscience 2020Quote: ... TH-Cre hPSC cells (passage were transduced with a lentiviral construct under control of the human TH-Cre promoter (Addgene, plasmid # …..). The cells were transduced at a multiplicity of infection (MOI ...
-
bioRxiv - Cancer Biology 2022Quote: The human NOTCH 1 intracellular domain (h1NICD) doxycycline-inducible expression plasmid (pLIX-h1NICD) was a gift from Julien Sage (Addgene #91897)11 ...
-
bioRxiv - Cancer Biology 2022Quote: ... we used the Gateway recombination system to introduce the following Myc ORF clone HsCD00039771 in pDONR221from the CCSB Human ORFeome Collection into pHAGE-TRE-DEST-NBioTAP (Addgene #53568) and pHAGE-TRE-DEST-CBioTAP lentiviral vectors (Addgene #53569) ...
-
bioRxiv - Cell Biology 2019Quote: ... Human N-WASP GBD domain was PCR amplified from pCS2-mRFP-GBD (a kind gift from William Bement, Addgene plasmid 26733) with XhoI/AscI flanking restriction sites and cloned into pET-pmKate2 to generate mKate-GBD ...
-
bioRxiv - Biophysics 2020Quote: The plasmid coding for human EGFR tagged with EGFP (hEGFR-EGFP) was a kind gift from Alexander Sorkin (Addgene plasmid #32751) (27) ...
-
bioRxiv - Immunology 2020Quote: ... Human G3BP1 cDNAs with or without stop codon were amplified by PCR from pN1/G3BP1-iRFP (Okada lab plasmids, Addgene #129339) with the sense primer 5′ -GCCAGATCTATGGTGATGGAGAAGCCTAG-3′ and the antisense primers 5′ -GCCGAATTCGGATCCTTACTGCCGTGGCGC-3′ or 5′ -GCCGAATTCGGATCCCTGCCGTGGCGCAAG-3′ ...
-
bioRxiv - Cell Biology 2021Quote: ... CFP-hRab5C(S35N).dn3 (#1006) encoding Cerulean-labeled dominant negative mutant version of human Rab5C isoform was from Addgene (Cat# 11504). GFP-hEEA1 (#970 ...
-
bioRxiv - Neuroscience 2020Quote: ... the insert consisting of GtACR2-ts-mCerulean3-βHK-Chrimson was cloned into an AAV2-backbone behind a human synapsin (hSyn) promoter (pAAV-hSyn-BiPOLES-mCerulean; Addgene #154944). A soma-targeted ...
-
bioRxiv - Genetics 2021Quote: ... were placed downstream of the human U6 promoter in the pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-Puro backbone (Addgene, #71236). The guide RNA sequences were:
-
bioRxiv - Molecular Biology 2020Quote: ... and RPL22-3xHA (primers JG106/109; human cDNA template) with EcoRI/PstI digested pLV-TetO-hNGN2-P2A-eGFP-T2A-Puro (Addgene #79823) backbone ...
-
bioRxiv - Immunology 2021Quote: ... A549ACE2 cells were generated using lentiviral transduction of a human ACE2 cDNA expressing plasmid (backbone: pLV-EF1a-IRES-Puro (Addgene 85132) as previously described [31] ...
-
bioRxiv - Cell Biology 2021Quote: ... a codon-optimized signal sequence from human ER-resident p23 was inserted into the AgeI site of p-sfGFP-N1 (Addgene #54737). p23ss-sfGFP lacking the stop codon was PCR amplified and flanked with a 3’ NheI site and TA cloned into pCRII-TOPO vector ...
-
bioRxiv - Cell Biology 2021Quote: ... WT and Lig4-/- abl pre-B cells and MCF10A human mammary epithelial cells used in this study all contain pCW-Cas9 (Addgene# 50661), which has a FLAG-tagged Cas9 cDNA under the control of a doxycycline-inducible promoter ...
-
bioRxiv - Neuroscience 2021Quote: Full-length human APLP1 gene with a Flag tag in the N-terminal was cloned from pCAX APLP1 (Addgene plasmid#30141) and the primers were shown in Key Resources Table (NheI-Flg-hAPLP1-F/XhoI-His-hAPLP1-R) ...
-
bioRxiv - Cell Biology 2020Quote: ... was made by amplifying TPD54 by PCR from human Tumor protein D54 (IMAGE clone: 3446037) and inserting into pIRES-EGFP-puro (Addgene #45567) via NheI and XhoI ...
-
bioRxiv - Cancer Biology 2021Quote: ... TERT+ cells were transiently transfected with human CA-FOXO1 (pcDNA3 Flag FKHR AAA mutant; gift from Kunliang Guan; Addgene plasmid # 13508) using polyethyleneimine ...
-
bioRxiv - Immunology 2022Quote: ... were transduced at 0.3 MOI by both part A and B of the pooled Human GeCKO v2 CRISPR library (Addgene, Cat#1000000049), and subsequently selected using 2 µg/mL puromycin (Calbiochem ...
-
bioRxiv - Cell Biology 2022Quote: ... The pHUJI-LC3B construct was cloned by inserting a codon-optimized gblock encoding pHUJI fused to the N-terminus of human LC3B into the NotI site of pENTR4 (Addgene #17424), and then Gateway-recombined with LR clonase II (Thermo Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... The mammalian expression vector for 3xFLAG-tagged human MGA produced by the laboratory of Guntram Suske was purchased from Addgene (#107715) and modified by overlap extension PCR to remove residues 1052-3065.
-
bioRxiv - Cell Biology 2022Quote: ... the same procedure was conducted to create and quantify the one-vector format Brunello human CRISPR knockout pooled library (Addgene #73179,59).