Labshake search
Citations for Addgene :
1201 - 1250 of 1574 citations for Mouse Anti Human Papilloma virus type 18 718 238 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... we cloned the human ACE2 cDNA sequence (NP_001358344.1) into a pLV-EF1a-IRES-Puro backbone vector (Addgene, cat no. 85132), and prepared lentiviral particles as described previously65 ...
-
bioRxiv - Genomics 2021Quote: Toronto human knockout pooled library (TKOv3) containing 71,090 based on a lentiCRISPRv2 backbone was a gift from Jason Moffat (Addgene #90294). The library was transformed and amplified using 25 μl Endura Competent Cells (Lucigen ...
-
bioRxiv - Genetics 2020Quote: Two pairs of gRNAs (Table S1 in “Supplementary file”) intermediated by human U6 (hU6) promoter were cloned after hU6 promoter of the plentiCRISPR_V2 plasmid (Addgene, #52961), according to Vidigal et al.’s protocol 34 ...
-
bioRxiv - Cell Biology 2022Quote: ... BirA-ACLY constructs were generated by inserting human ACLY into pcDNA3.1 mycBioID vector (N-terminal MYC-BirA, Addgene, plasmid 35700) with a 16 or 46 amino acid linkers between ACLY and BirA ...
-
bioRxiv - Biophysics 2022Quote: ... and 32C (residues 172–270 of RPA2) domains of human RPA were PCR amplified using p11d-tRPA plasmid (Addgene plasmid102613) (Henricksen et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRNA for human ATP6V0C (5’-GAATAGTCGGGGCTGCTGGG-3’) and ATP6V0D1 (5’-TCGATGACTGACACCGTCAG-3’) were cloned to lentiCRISPR v2 plasmid (Plasmid #52961, Addgene), followed by virus package and infection procedures as described previously69 ...
-
bioRxiv - Microbiology 2022Quote: ... C-terminal FLAG-tagged TMPRSS2 orthologues and the human ΔHDS mutant were ligated into the lentiviral pWPI-BLR vector (Addgene) via restriction digestion or using HiFi Builder (NEB) ...
-
bioRxiv - Molecular Biology 2022Quote: ... a plasmid expressing human Ago2 fused to GFP in the N-terminal region of Ago2 was obtained from Addgene (11590). For recombinant protein purification ...
-
bioRxiv - Neuroscience 2022Quote: ... and fused in frame without a linker to human H2B (H2BC11) (accession #NM_021058) and cloned into the pAAV-CAG-tdTomato (Addgene #59462) using the sites KpnI and EcoRI at the 5 and 3 prime end respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... An AAV8 encoding the inhibitory designer receptor KORD fused to the fluorescent protein mCitrine under the control of the human synapsin promoter in a Cre-dependent manner was obtained from Addgene (AAV8-hSyn-dF-HA-KORD-IRES-mCitrine ...
-
bioRxiv - Neuroscience 2023Quote: ... encoding the Cre enzyme fused to the green fluorescent protein (GFP) under the control of the human synapsin promoter was obtained from Addgene (AAVrg.hSyn.HI.eGFP-Cre.WPRE.SV40 ...
-
bioRxiv - Microbiology 2022Quote: ... The Jun-Nt VFP (Jun) and Fos-Ct VFP (Fos) and the human ACE2 and TMPRSS2 expressing plasmids were obtained from Addgene (#22012 ...
-
bioRxiv - Neuroscience 2022Quote: Full length human TAOK1 was obtained from Transomics Technologies in PCR-XL-Topo plasmid and inserted into sfGFP-C1 (Plasmid #54579, Addgene), using the EcoRI and MfeI sites ...
-
bioRxiv - Genetics 2024Quote: ... pLenti-CMV-HA-HHIP lentiviral expression plasmid was generated by subcloning the appropriate human HHIP cDNA PCR fragment into pLenti-CMV Blast (659–1) (Addgene). HA-tag was inserted into human HHIP cDNA after Ala 23 ...
-
bioRxiv - Genetics 2024Quote: The IS621 recombinase gene was human codon optimized and cloned into a modified pFastBac expression vector (Addgene, Item ID: 30115), which includes an N-terminal His6-tag ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... A human elongation factor 1 (EF1) promoter was introduced using a Gateway att4-att1 Entry clone (Addgene, Watertown, MA, #162920). Final expression clones were verified by restriction analysis and maxiprep DNA was prepared using the Qiaprep Maxiprep kit (Qiagen ...
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNA vectors targeting TTCACACATACAATGCACTG and GATGGTAAGCCTCATCACAG of the human HIF-1α gene (ENSG00000100644) were cloned into the pLH-spsgRNA2 vector (64114, Addgene). For GHRH-R activation ...
-
bioRxiv - Neuroscience 2023Quote: ... The Ube3a expression construct was generated by amplifying the coding sequence of human Ube3a isoform III from Plasmid #37605 (Addgene) with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The coding sequence of the catalytic domain of human KDM6B (1025–1680 aa) was obtained from the MSCV_JMJD3 plasmid (Addgene #21212) (Sen et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... RAD52KO and RAD52WT cells were transduced at a low multiplicity of infection (MOI<0.3) using the BFP-tagged Human Improved Genome-wide Knockout CRIPSR Library (Addgene #67989) (Tzelepis et al ...
-
bioRxiv - Neuroscience 2023Quote: ... The the AAV carrying the plasmid coding for iGluSnFR under the human synapsin promoter (pAAV.hSyn.iGluSnFR.WPRE.SV40) was a generous gift from Laren Looger (Addgene viral prep # 98929-AAV9) or produced in our own laboratory ...
-
bioRxiv - Biochemistry 2023Quote: ... Lentiviruses with this construct were produced by transfecting human embryonic kidney 293T (HEK 293T) cells with pKS18 and the lentiviral packaging vectors pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Neuroscience 2023Quote: Two-cell-stage embryos were bilaterally injected with 400 pg human EEA1 tagged to GFP (GFP-EEA1 wt was a gift from Silvia Corvera; Addgene plasmid # 42307 ...
-
bioRxiv - Molecular Biology 2023Quote: - recombinant pGEX-4T-3-P53: The human-p53 cDNA was previously cloned in the EcoRI site of pGEX-4T3 (Addgene_79149) under the lac-trp hybrid promoter that is inducible by IPTG ...
-
bioRxiv - Microbiology 2023Quote: ... targeting the first exon of the human AHR gene (NM_001621) was cloned into BsmBI-digested Cas9 plasmid lentiCRISPR v2 (Addgene #52961). The resulting plasmid (pLentiCRISPRv2-sgAhR ...
-
bioRxiv - Cell Biology 2023Quote: ... pAP1σ1-RFP (for expression of fluorescently-tagged APα1 in human cells) was cloned by Gibson assembly using sequences derived from pAP1α1-eGFP (Addgene plasmid 53611) and pTagRFP-RAB2A (provided by S ...
-
bioRxiv - Neuroscience 2023Quote: A 2.2 kb BamHI-SalI cDNA fragment of the long form of human PREPL (PREPLL) was cloned into pLenti-GFP (Addgene) digested with the same restriction enzymes ...
-
bioRxiv - Biochemistry 2023Quote: ... human EZH2 wildtype and the K20R or S21A mutant of human EZH2 were cloned into the retroviral pMSCV-Puro vector containing 3xFlag-3xHA epitope (Addgene) and the recombinant retroviruses were packaged in 293 cells (Guo et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... CAFs were immortalized with stable expression of human telomerase reverse transcriptase (pBABE-neo-hTERT was a gift from Bob Weinberg (Addgene plasmid # 1774 ...
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNA vectors targeting TGTCAGGGGACAGCAGGGGA and AGCAGAGGGTGCGGTGGAAA of the human GHRHR gene (ENSG00000106128) were cloned into the lenti-sgRNA (MS2) puro backbone vector (73795, Addgene). Lentiviral particles were generated by transient co-transfection with the pMD2.G (12259 ...
-
bioRxiv - Cell Biology 2023Quote: The human sFLT1-HA plasmid construct created through Gibson cloning of human sFLT1 cDNA into a pcDNA3.1 vector containing a C-terminal HA tag (pcDNA3-ALK2-HA, Addgene 80870). Sequencing validation was performed through Genewiz ...
-
bioRxiv - Biophysics 2023Quote: ... 3C protease site cloned into a pcDNA3 vector containing human IgG Fc derived from pcDNA3-Nrxn1beta AS4(-)-Fc (a gift from Peter Scheiffele & Tito Serafini, Addgene plasmid # 59313 ...
-
bioRxiv - Immunology 2023Quote: ... MAP3K20 (ZAKα) KO human primary keratinocytes were generated using lentiviral Cas9 and guide RNA plasmid (LentiCRISPR-V2, Addgene plasmid #52961) using the following guides ...
-
bioRxiv - Microbiology 2022Quote: ... sequences targeting human SFPQ were designed using the CRISPOR tool (http://crispor.tefor.net) and cloned into pX459-V2 vector (Addgene Plasmid #62988). Briefly ...
-
bioRxiv - Immunology 2023Quote: ... Human foreskin fibroblasts (HFF, SCRC- 1041, ATCC) were immortalized using a human telomerase-expressing retrovirus (pWZL-Blast- Flag-HA-hTERT, 22396, Addgene).
-
bioRxiv - Genetics 2023Quote: Two sgRNA oligonucleotide probes targeting different sites in human PIF1 and RAD52 or non-target were cloned into lentiCRISPRv2 puro (Addgene). Plasmids that contain each sgRNA were transfected to HEK293T cells using Lenti-X packaging single shots (Takara ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV encoding the cre-inducible inhibitory designer receptor human M4 muscarinic receptor (hM4DGi; AAV2-Syn-DIO-hM4Di-mCherry; Addgene) or fluorophore control (AAV2-Syn-DIO-mCherry ...
-
bioRxiv - Neuroscience 2023Quote: Cortical expression of the calcium sensor GCaMP7c was attained via focal viral injection of AAV1 under the human synapsin (hsyn) promoter for broad neuronal expression (#105321, Addgene).41 CD-1 male mice (P42-56 ...
-
bioRxiv - Cancer Biology 2024Quote: The chimeric antigen receptor against human CD276 (Du et al., 2019) and CD19 (Maude et al., 2018)together with the Thy1.1 surface antigen (Addgene 154194)(Umkehrer et al. ...
-
bioRxiv - Microbiology 2023Quote: Human and cat ACE2 expressing lentiviral plasmids (pscALPS-hACE2 and pscALPS-cACE2) were obtained from Addgene (158081 and 158082, respectively). Each gene was tagged with a c-terminal Myc-tag epitope to facilitate detection ...
-
bioRxiv - Cancer Biology 2023Quote: ... we designed single guide RNAs to target the exon 1 of the human Per2 gene and subcloned it into the PX459 vector (Addgene) to obtain the PX459-Per2 plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... The Scrib-Flag plasmid was generated by amplifying human Scrib coding sequence from MSCV Puro SCRIB WT (Addgene, Cat# 88886) and fused with 3xFlag tag at the C-terminal in pcDNA3 backbone ...
-
bioRxiv - Cell Biology 2023Quote: A plasmid for expression of full-length human KIF1C (pKIF1C-GFP) was a gift from Anne Straube (Addgene plasmid #130977107). All truncated versions of KIF1C (see Resource Table) ...
-
bioRxiv - Cancer Biology 2024Quote: Murine KSR1 (resistant to degradation by sgRNA sequences targeting human KSR1) was cloned into MSCV-IRES-KSR1-RFP (Addgene #33337) and PEI transfected into HEK293T cells along with pUMVC retroviral packaging construct (Addgene #8449 ...
-
bioRxiv - Neuroscience 2024Quote: ... were cloned by PCR amplification of human LGals3 and LGals8 cDNAs from the pHAGE-mKeima-LGALS3 and pHAGE-FLAG-APEX2-LGALS8 plasmids (Addgene plasmids #175780 and #175758 ...
-
bioRxiv - Cancer Biology 2024Quote: Truncated CPSF6 containing amino acids 1-358 (CPSF6-358) from human isoform 1 was cloned into the pCW57.1 backbone (Addgene 71782). A hemagglutinin (HA ...
-
bioRxiv - Microbiology 2024Quote: ... annealing to exon 4 of the ORF of the human BST2 gene was designed and cloned into lentiCRISPR v2 (Addgene). Next ...
-
bioRxiv - Microbiology 2021Quote: ... lentivirus that harbored the mouse GeCKOv2 sgRNA library in the lentiCRISPRv2 vector (Addgene) was produced in HEK293FT cells (Thermo Fisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... GFP-PGC1 plasmid expressing eGFP-tagged mouse PGC1a was acquired from Addgene(50). For in vivo electroporation ...
-
bioRxiv - Neuroscience 2021Quote: ... one DATcre mouse was injected with AAV8-hSyn-DIO-mCherry (Addgene, cat#50459) in midbrain (SNc ...