Labshake search
Citations for Addgene :
1401 - 1450 of 10000+ citations for Human GSDMC shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: The hSTARR-seq_ORI plasmid vector was a gift from Alexander Stark (Addgene plasmid #99296) and the pcDNA3-EGFP was a gift from Doug Golenbock (Addgene plasmid #13031) ...
-
bioRxiv - Neuroscience 2022Quote: ... The donor plasmids were constructed by modifying the AAVS1-CAG-hrGFP (Addgene plasmids #52344) and replacing the GFP with Cas9 (Addgene plasmids #42230) ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were co-transfected with 750 ng of pCMV-PE2 Plasmid (Addgene Plasmid #132775) and 250 ng of assembled pU6-pegRNA-GG-acceptor using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Bioengineering 2022Quote: ... nanopore reads were aligned to plasmids carrying either gFLE (1154B, Addgene as plasmid #187238) or Cas9 (21 ...
-
bioRxiv - Cell Biology 2023Quote: ... a lentiviral plasmid pLJC5-3XMyc-EGFP-PEX26) was directly purchased from Addgene (Plasmid, #139059). Lentivirus production and transduction of HeLa cells were done similarly as mentioned above.
-
bioRxiv - Genomics 2022Quote: The lentivirus backbone plasmid was a gift from Kazuhiro Oka (Addgene plasmid #72263, RRID:Addgene_72263). This vector was digested with BspDI and KpnI and gel purified ...
-
bioRxiv - Immunology 2022Quote: ... and −8 were cloned into the LentiCRISPR v2 plasmid (Feng Zhang, Addgene plasmid #52961). The sequences for the guide RNAs were as follows ...
-
bioRxiv - Microbiology 2023Quote: ... The HMGB1 sequence was obtained from the pcDNA3.1 Flag hHMGB1 plasmid (Addgene plasmid #31609).
-
bioRxiv - Molecular Biology 2023Quote: ... the transfer plasmid was co-transfected with the envelope plasmid pMD2.G (Addgene #12259) and the second-generation packaging plasmid psPAX2 (Addgene #12260 ...
-
bioRxiv - Synthetic Biology 2023Quote: The pTRKH2 plasmid was akind gift from Rodolphe Barrangou & Todd Klaenhammer (Addgene plasmid #71312). pTRKH2 is a theta replicative plasmid carrying a pAMβ1 origin (high copy number) ...
-
bioRxiv - Immunology 2023Quote: The SP-dCas9-VPR plasmid was a gift from George Church (Addgene plasmid, #63798).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The CMV-hEAAT3 plasmid was a gift from Susan Amara (NIMH; Addgene plasmid #32815). The pH1R-P2A-mCherry-N1 was a gift from Dorus Gadella (Addgene plasmid # 84330 ...
-
bioRxiv - Bioengineering 2023Quote: ... coli were transformed with plasmid containing the ampicillin resistance gene (pUC19, Addgene Plasmid #50005) and streaked on LB agar plates spiked with 100 µg/mL ampicillin ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 ug of DNA (the pegRNA plasmid and the pCMV-PE2 plasmid (Addgene #132775) at a 1:2 ratio by mass of pegRNA plasmid:PE2) ...
-
bioRxiv - Cell Biology 2023Quote: ... and the lentiviral plasmid (pLVSIN-PIP-FUCCI or pBOB-EF1-FastFUCCI (Addgene; plasmid # 86849), which was a gift from Kevin Brindle & Duncan Jodrell) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plasmid HaloTag-KEAP1 (a gift from Yimon Aye, plasmid # 58240) was purchased from Addgene. HiBit-CDK9 were constructed through the Gibson assembly method ...
-
bioRxiv - Genomics 2022Quote: The lentivirus backbone plasmid was a gift from Kazuhiro Oka (Addgene plasmid #72263, RRID:Addgene_72263). This vector was digested with BspDI and KpnI and gel purified ...
-
bioRxiv - Genetics 2023Quote: ... or the CRISPR screen plasmid library was mixed with helper plasmids psPAX2 (Addgene, 12260) and pVSV-G (Addgene ...
-
bioRxiv - Developmental Biology 2023Quote: ... Both the donor plasmid and the two guide RNA plasmids (pU6-BbsI-chiRNA, RRID:Addgene_45946) for each gene were injected into Cas9 embryos (BDSC Stock #51324 ...
-
bioRxiv - Cell Biology 2023Quote: ... The CYFIP2-mCherry containing plasmid was a gift from Josef Kittler (Addgene plasmid # 122052). The ECFP-betaPIXa containing plasmid was a gift from Rick Horwitz (addgene #15235) ...
-
bioRxiv - Biochemistry 2023Quote: ... and TAF15 were amplified from the plasmids of the wtTDP43– tdTOMATOHA (Addgene, plasmid #28205), GST–TEV–FUS (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: Reporter plasmid (pBOB-EF1-FastFUCCI-Puro, Addgene-plasmid # 86849; http://n2t.net/addgene:86849; RRID:Addgene_86849) was made by Kevin Brindle & Duncan Jodrell (Koh et al ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The plasmid ADORA1-Tango (Addgene plasmid #66209; http://n2t.net/addgene: 66209; RRID: Addgene_ 66209) used as template was a gift from Bryan Roth (Kroeze et al. ...
-
bioRxiv - Cancer Biology 2024Quote: Plasmid expressing constitutively activate RhoA was ordered from Addgene (pSLIK CA RhoA, Plasmid #112894) (MacKay and Kumar ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids pLJM1-FLAG-GFP-OSBP was from Addgene (Plasmid #134659; (Lim et al., 2019)) ...
-
bioRxiv - Microbiology 2023Quote: The T444T plasmid was a gift from Tibor Vellai (Addgene plasmid #113081; RRID: Addgene_11308123). GFP and target viral sequences were cloned into T444T using NotI and AgeI restriction sites and standard cloning techniques ...
-
bioRxiv - Microbiology 2023Quote: ... we introduced the p1NIL-melH plasmid with the pGOAL19 cassette (Addgene plasmid number 20190) using the protocol described by Parish and Stoker (37) ...
-
bioRxiv - Cancer Biology 2023Quote: ... along with the packaging plasmids psPAX2 (a gift from Didier Trono; Addgene plasmid #12260) and pMD2.G (VSV-G envelope ...
-
bioRxiv - Biochemistry 2023Quote: ... Then PCR products were Gibson-cloned into the PEmax mRNA plasmid (Addgene plasmid #204472) digested with RsrII and XhoI enzymes ...
-
bioRxiv - Genetics 2023Quote: ... The gRNA plasmid libraries were combined with VSVg (Plasmid #8454, Addgene, Watertown, MA, USA) and psPAX2 (Plasmid #12260 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 3 μg of PX459 plasmid (kind gift from Feng Zhang; Addgene plasmid ##62988) expressing both cas9 and a cloned gRNA (5’-TCTCCCATGCATTCAAACTG-3’ ...
-
bioRxiv - Immunology 2023Quote: ... Addgene plasmid # 30174)93 or the pMSP12::mCherry plasmid (a gift from Lalita Ramakrishnan; Addgene plasmid # 30167) to generate Mtb-Wasabi and Mtb-mCherry ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Plasmids encoding NS3a and CP5 were obtained from Addgene (Addgene plasmid #133608 and #133614). Cloning was performed similarly to the peptide-based CAST designs through PCR amplification and Gibson Assembly of the fragments.
-
bioRxiv - Cell Biology 2023Quote: ... in addition to the plasmid pLVX-UbC-rtTA-Ngn2:2A:EGFP (Addgene Inc., Plasmid 127288). Plasmids were removed after 8 hours ...
-
bioRxiv - Genomics 2023Quote: ... and the URA3 cassette was amplified by PCR from plasmid pWS158 (Addgene plasmid #90517). The amplified DNA fragments ...
-
bioRxiv - Molecular Biology 2023Quote: ... The Cas9 mRNA was in vitro transcribed from pSpCas9 plasmid (PX165; Addgene plasmid #48137) using Ambion mMESSAGE mMACHINE T7 Transcription Kit ...
-
Arc mediates intercellular synaptic plasticity via IRSp53-dependent extracellular vesicle biogenesisbioRxiv - Neuroscience 2024Quote: ... pLVX-eGFP-Cre (plasmid #86805) and pLVX-GFP (plasmid #17448) were purchased from Addgene. IRSp53 I-BAR domain was amplified from the pLVX-IRSp53 plasmid and ligated into a pRK5-myc backbone using SalI and NotI.
-
bioRxiv - Cancer Biology 2024Quote: ... cells were transduced with lentivirus generated from the PIP-FUCCI plasmid (Addgene plasmid #138715) as described above ...
-
bioRxiv - Developmental Biology 2024Quote: Plasmid pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A) (Addgene, plasmid #42335; Cong et al., 2013) was used to synthesize DNA templates containing the single guide (sg)RNA scaffold ...
-
bioRxiv - Developmental Biology 2024Quote: ... The Minos transposase (pBlueSKMimRNA) plasmid was a gift from Michalis Averof (Addgene plasmid #102535). The piggyBac transposase (pT7mRNA-PB transposase ...
-
bioRxiv - Cell Biology 2024Quote: ... a pME-Lifeact (65) plasmid was a gift from Rob Parton (Addgene plasmid #109545). Using gateway cloning ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the viral envelope plasmid pMD2.G (gift from Didier Trono; Addgene plasmid # 12259) using Lipofectamine 3000 Transfection Reagent (Invitrogen) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The plasmids pOSIP-TH (Addgene plasmid # 45978 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... lentiMPH v2 (Addgene plasmid #89308) and lenti sgRNA(MS2)_puro backbone (Addgene plasmid #73795)11 were gifts from Feng Zhang.11 ...
-
bioRxiv - Cancer Biology 2021Quote: Cas9-mCherry (Addgene Plasmid #70182) was used to generate stable Cas9-expressing cell lines ...
-
bioRxiv - Cancer Biology 2021Quote: ... pRSV-REV (Addgene Plasmid #12253) and pVSVg (Addgene Plasmid #12259) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pVSVg (Addgene Plasmid #12259). Lentivirus containing supernatants were harvested and transduced into AML cell lines with 4 μg/ml sequabrene (Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2021Quote: ... and psPAX2 (Addgene plasmid 12260) were gifts from Didier Trono ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pSLQ plasmid (Addgene # 51024) cloned with a tRNAIleGAU targeting guide (5’ TGAGCTAACCGGCCGCCCGA 3’) ...
-
bioRxiv - Cancer Biology 2021Quote: ... pMD2.G (Addgene plasmid # 12259) into HEK293T ...