Labshake search
Citations for Addgene :
1351 - 1400 of 2285 citations for Rat Carboxypeptidase A3 Mast Cell CPA3 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviruses were produced using a similar procedure with 293T cells using the psPAX2 plasmid (Addgene, 12260) instead of pUMVC.
-
bioRxiv - Microbiology 2023Quote: ... cells were co-transfected with 0.5 μg of pCMV(CAT)T7-SB100 (transposase vector; Addgene, 34879) and 5 μg of pSBbi or pSBtet containing gene of interest using TransIT-LT1 transfection reagent (Mirus Bio) ...
-
bioRxiv - Molecular Biology 2023Quote: ... with 3 million K562 cells and 10 µg of pCMV-PE2-tagRFP-BleoR (Addgene no. 192508) per individual electroporation (Day 0) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The control and ERBB2 OE cells were generated using retroviral vectors pBABE-puro (Addgene, cat# 1764) and pBABEpuro-ERBB2 (Addgene ...
-
bioRxiv - Bioengineering 2023Quote: HEK293T cells were transfected with ACE2- and TMPRSS2-expression plasmids (RRID: Addgene_141185 and RRID: Addgene_145843, respectively) to allow infection by pseudo-viruses as previously described [12] ...
-
bioRxiv - Cancer Biology 2023Quote: ... 293FT cells were co-transfected using (per condition) 3 µg of pLKO.GFP transfer plasmid (Addgene, #30323) containing the shRNA (sequences in Supplementary Table S6) ...
-
bioRxiv - Immunology 2023Quote: ... mouse naïve CD4+ T cells were transfected with p8xEGFP-N1 (Addgene # 122168, gift from Georg Mayr) which expresses 8 concatemeric EGFP proteins ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were co-transfected with 900 ng psPAX2 (psPAX2 was a gift from Didier Trono (Addgene plasmid #12260 ...
-
bioRxiv - Cell Biology 2024Quote: ... Intracellular H2O2 was assessed using cells transiently transfected with cytosol-targeted pCS2+HyPer7-NES (Addgene #136467). Fluorescence ratios Ex490/Ex405nm and Em 535 were obtained every 30s for 30min using the Synergy Neo2 plate reader ...
-
bioRxiv - Cancer Biology 2024Quote: ... The constructs were PEI transfected into HEK293T cells along with psPAX2 lentiviral packaging construct (Addgene #12259) and pMD2.G envelope construct (Addgene #12259) ...
-
bioRxiv - Cancer Biology 2024Quote: ... HEK293T cells were transfected with the luciferase reporter construct TBS-Luc (8XGTIIC-Luc, cat. 34615, Addgene, 8xGTIIC-luc was a gift from Stefano Piccolo) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The constructs were PEI transfected into HEK293T cells along with psPAX2 lentiviral packaging construct (Addgene #12259) and pMD2.G envelope construct (Addgene #12259) ...
-
Autophagy suppression in DNA damaged cells occurs through a newly identified p53-proteasome-LC3 axisbioRxiv - Cell Biology 2024Quote: ... cells were transfected with a Myc-tagged LC3 ectopic expression plasmid (pCMV-myc-LC3; #24619, Addgene) using Lipofectamine 3000 transfection reagent (#L300015 ...
-
bioRxiv - Molecular Biology 2024Quote: ... the cells were transfected with pGL3 containing three repeats of the GATA consensus site (Addgene #85695) and pGL4.74 vector together with pMYS-IN vector or pMYs-NGFR-GATA2 and pMYs-IG vector ...
-
bioRxiv - Molecular Biology 2024Quote: Lentiviral vectors were produced by transfection of HEK 293T cells with the envelope (psPAX2, Addgene #12260), packaging (pMD2.G ...
-
bioRxiv - Cancer Biology 2024Quote: ... lentiCRISPRv2 constructs were independently packaged into lentiviral particles in HEK293T cells with psPAX2 (Addgene cat. 12260) and pMD2.G (Addgene cat ...
-
bioRxiv - Molecular Biology 2024Quote: Cell lines stably expressing Cas9 were generated by transduction using pKLV2-EF1a-Cas9Bsd-W (Addgene #68343) lentiviral particles in the presence of 8μg/ml polybrene (Merck ...
-
bioRxiv - Cancer Biology 2024Quote: HEK293T cells were transfected with a shuttle vector plasmid and packaging plasmids pMD2.G (Addgene, #12259) and psPAX (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were transduced with the Human CRISPR Knockout Pooled Library16 (Brunello, lentiCRISPR v2, Addgene 73179-LV) at ∼MOI 0.3 with 8 µg/ml polybrene ...
-
bioRxiv - Immunology 2024Quote: ... Plat-e cells were co-transfected with the cloned vectors and pCL-eco (cat. 12371, Addgene) in Opti-MEM (cat ...
-
bioRxiv - Microbiology 2024Quote: ... 293T cells were transfected with psPAX2 and pMD2.G (gifts from Didier Trono – Addgene #12260, #12259) and pTRIPZ lentiviral vectors ...
-
Progerin Can Induce DNA Damage in the Absence of Global Changes in Replication or Cell ProliferationbioRxiv - Molecular Biology 2024Quote: ... cell line pLB4/11 was stably transfected with plasmid pBABE-puro-GFP-progerin (Addgene plasmid # 17663) as described [45] ...
-
bioRxiv - Cancer Biology 2021Quote: ... H4 human GBM cells were infected with the whole-genome knockout Brunello library (Addgene, Cambridge, MA, USA), which included ∼19,000 genes with 4 sgRNAs per gene and 10,000 sgRNA non-targeting controls ...
-
bioRxiv - Cancer Biology 2021Quote: ... MCF7 and MCF7-F cells were infected with pLenti-CMV-puro-Luc lentiviral luciferase construct (Addgene 17477) to monitor tumor growth ...
-
bioRxiv - Molecular Biology 2019Quote: ... dCas9-expressing cells were then infected with the MS2-P65-HSF1 activator helper complex (Addgene, 61426-LVC) and treated with 0.5 mg/ml hygromycin ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were transfected by JetPEI (Ozyme) according to manufacturer’s instructions with either an empty px330 plasmid (Addgene) coding only for Cas9 or a px330 plasmid coding for Cas9 and a sgRNA targeting rDNA [13] ...
-
bioRxiv - Immunology 2021Quote: ... GL261-OVA was generated by transducing parent cells with ovalbumin cloned from pcDNA3-OVA (Addgene plasmid # 64599). Transduction was performed as described (85) ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293 cells were transfected with 4µg shRNA p53-puromycin (Fachinetti Lab) + 4µg pMD2.G (12259 from Addgene, RRID:Addgene_12259) + 4µg psPAX2 (12260 from Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... new lentiviral particles were produced by transfecting HEK293 cells with 4µg Apple-53BP1trunc (69531 from Addgene, RRID:Addgene_69531) + 4µg pMD2.G (12259 from Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... new lentiviral particles were produced by transfecting HEK293 cells with 4µg Apple-53BP1trunc (69531 from Addgene, RRID:Addgene_69531) + 4µg pMD2.G (12259 from Addgene ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were transiently transfected with pRK5-myc-Rac1-Q61L (Addgene plasmid # 12983; http://n2t.net/addgene:12983; RRID:Addgene_12983) with Lipofectamine (ThermoFisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... Each sgRNA lentiviral construct was transfected into HEK 293T cells along with packaging vectors psPAX2 (Addgene #12260) and pCMV-VSV-G (Addgene #8454 ...
-
bioRxiv - Cell Biology 2022Quote: ... WT and FIP200 KO HeLa cells were cotransfected with the DNA fragment and the PX459 (Addgene #48139)-based plasmid expressing Cas9 and gRNA (GTCTTAGAAGCCGTGAGGTA for the NCOA4 gene ...
-
bioRxiv - Microbiology 2020Quote: ... the mouse cDNA sequence of IRE1 from MEF cells was inserted into pcDNA3- EGFP plasmid (Addgene #13031), resulting in fusion proteins with the EGFP fused to the carboxy terminus of IRE1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... For expression in Drosophila S2 cells (68) the mtSSB coding sequence was cloned into pMT-puro (Addgene) using a two-step procedure ...
-
bioRxiv - Cell Biology 2020Quote: ... the Cas9 and mCherry for detection of electroporated cells were obtained from Addgene (plasmids #66939, #66940, #66941). All targeting constructs (for both HDR and NHEJ ...
-
bioRxiv - Neuroscience 2019Quote: Δe11- and +e11-Cacna1d splice variants were transiently expressed in human tsA201 cells with CaVβ3 (Addgene, 26574), CaVα2δ-1 (Addgene ...
-
bioRxiv - Cancer Biology 2019Quote: ... cells were transduced with lentiviral particles produced using vector pHRdSV40-scFv-GCN4-sfGFP-VP64-GB1-NLS (Addgene #60904 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10cm plate) cells were transfected using PEI with psPAX2 (3.5µg, a gift from Didier Trono, Addgene #12260), pMD2.G (1.5µg ...
-
bioRxiv - Molecular Biology 2019Quote: ... K562 cells were transduced with EZ-Tet-pLKO-Hygro (a gift from Cindy Miranti, Addgene plasmid #85972) containing either HMG20A- ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3T3 cells were transfected with the gRNA-expressing plasmids and the Cas9-expressing plasmid hCas9 (Addgene #41815) using Lipofectamine LTX reagent (Thermo Fisher #15338100 ...
-
bioRxiv - Cancer Biology 2019Quote: U2OS-EJ7 cells were infected with viruses produced in HEK293T using second generation vectors psPAX2 (Addgene #12259) as packaging plasmid ...
-
bioRxiv - Bioengineering 2019Quote: GV-expressing cells were produced by transforming a pET28a plasmid containing the arg1 gene cluster12 (Addgene #106473) into BL21(A1 ...
-
bioRxiv - Cell Biology 2019Quote: ... AICSDP-1:PXN-EGFP was a gift from The Allen Institute for Cell Science (Addgene plasmid 87420).
-
bioRxiv - Bioengineering 2020Quote: ... either of the two cell types was subjected to Lipofectamine transfection with CMV-R-GECO1.2-mCherry (Addgene, Watertown ...
-
bioRxiv - Bioengineering 2020Quote: VSV-G pseudotyped lentivirus was produced via transfection of HEK 293T cells (ATCC) using psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) ...
-
bioRxiv - Bioengineering 2020Quote: ... Cells were infected to express genetically encoded multimeric nanoparticles (GEMs) using lentiviral construct from Addgene (Plasmid #11693416). Cells were FACS sorted to purify population of cells expressing GEMs.
-
bioRxiv - Cell Biology 2021Quote: HEK-293T knockout cell lines were generated by transient transfection of pSpCas9(BB)-2A-Puro (Addgene 48139) encoding U6 driven expression of sgRNAs (Scramble Guide ...
-
bioRxiv - Microbiology 2020Quote: Huh7.5.1-Cas9 cells were generated by lentiviral transduction with lentiCas9-blast (Addgene, #52962, gift from Feng Zhang) and subsequently selected with blasticidin for 7 days ...
-
bioRxiv - Microbiology 2021Quote: ... A375-dCas or HeLa-dCas cells were generated by transducing with pLenti-dCas9-VP64-Blast (Addgene, #61425). After 7 days of blasticidin selection ...