Labshake search
Citations for Addgene :
1601 - 1650 of 2285 citations for Rat Carboxypeptidase A3 Mast Cell CPA3 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Lentiviral particles were harvested from supernatants of HEK293T cells that had been co-transfected with psPAX2 (Addgene 12260), pMD2.G (Addgene 12259) ...
-
bioRxiv - Cell Biology 2023Quote: ... in HEK 293T cells (ATCC, VA) using 3rd generation lentiviral packaging plasmids pMDLg/pRRE (Addgene Inc., Plasmid 12251) and pRSV-RV (Addgene Inc. ...
-
bioRxiv - Cell Biology 2023Quote: ... we measured intramitochondrial free Ca2+ levels by transfecting AML12 cells with the CMV-mito-GEM-GECO1 plasmid (Addgene, 32461 ...
-
bioRxiv - Immunology 2023Quote: ... CHD4 KO cells was similarly transfected with piggy bac plasmid encoding dCas9-KRAB-MeCP2 (45) (Addgene plasmid #110821) and selected with 10 µg/ml blasticidin for 1week then infected with lentiviruses expressing different guide RNAs under U6 promoter.
-
bioRxiv - Cancer Biology 2023Quote: ... we transfected Cos7 cells with Cx43-GFP (gift from David Spray (Addgene plasmid #69007; http://n2t.net/addgene:69007;RRID:Addgene_69007) (95) ...
-
bioRxiv - Cell Biology 2023Quote: ... UGGT2-/- and UGGT1/2-/-HEK 293T cells were generated using the CRISPR/Cas9 system from Addgene (http://www.addgene.org/). The sequences for guide RNAs were obtained from http://tools.genome-engineering.org and https://www.addgene.org/pooled-library/zhang-human-gecko-v2/ ...
-
bioRxiv - Cell Biology 2023Quote: ... MEF cells were transiently transfected with DRP1 K38A (gift from Alexander van der Bliek & Richard Youle55, Addgene, 45161) using Metafectene Pro (Biontex ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were transfected with the plasmid pcDNA3_erGAP2 (a gift from Teresa Alonso and Javier García-Sancho, Addgene #78120), which encodes a low affinity fluorescent calcium biosensor ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviruses were generated by transfection of 293T cells with the indicated expression plasmid and the psPAX2 (Addgene 12260) and pVSVG (Addgene 14888 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentivirus was generated by co-transfection of HEK293 cells with viral vector and packaging plasmids psPAX2 (Addgene 12260) and pMD2.G (Addgene 12259 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were plated in 6-well plate and co-transfected with SBE4-Luc plasmid (1 μg, Addgene,16495) and pDEST26-Renilla plasmid (0.1 μg ...
-
bioRxiv - Microbiology 2023Quote: Lentiviral vector stocks were obtained by transfection of 6.5 x 106 HEK293T cells with packaging vector gag-pol-rev (pCMV-dR8.74, #22036, Addgene), a vesicular stomatitis virus G (VSV-G ...
-
bioRxiv - Cell Biology 2023Quote: ... U2OS-Cas9 and U2OSp53KO-Cas9 cells were generated using viral transduction of the lentiCas9-Blast plasmid (Addgene, #52962), followed by a 5-day selection with 5 µg/mL blasticidin ...
-
bioRxiv - Molecular Biology 2023Quote: XEN cells were infected with lentiviruses harboring the pHR–SFFV–dCas9–BFP–KRAB vector (Addgene, cat. no. 46911), while ESC v6,5 cells were infected with a modified version of the plasmid in which the SFFV promoter was replaced with an Ef1a promoter 42 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lung KP cells stably expressing a hypoxia reporter (pLenti-5XHRE-GFP, Addgene #128958, denoted here as HRE-GFP), cell membrane marker (pLenti-mCherry-CAAX ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... RBL-2H3 cells were transfected with the mitochondrial calcium indicator pCMV CEPIA2mt (a gift from Masamitsu Iino; Addgene plasmid # 58218 ...
-
bioRxiv - Synthetic Biology 2023Quote: Reporter plasmid was co-transformed with accessory and selection plasmids of interest into electrocompetent S1030 cells (Addgene #105063) and recovered using Davis rich media60 (DRM) ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293T cells (between passage 9-11) were transfected with lentiviral packaging vector psPAX2 (#12259, Addgene, Watertown, MA, USA), the envelope vector pMD2.G (#12260 ...
-
bioRxiv - Genomics 2023Quote: AAV production was performed by transfecting 293FT cells with 22 ug of pDGM6 helper plasmid (Addgene plasmid # 110660), 6 ug of donor template plasmid ...
-
bioRxiv - Genetics 2023Quote: ... 293T cells were transfected with 7.5 μg of of the plasmid pCMVR8.74 (a gift from Didier Trono (Addgene plasmid #22036 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were transfected using 30 μg of pMSCV-loxP-dsRed-loxP-eGFP-Puro-WPRE plasmid (Addgene, Plasmid #32702) or pMSCV-loxP-dsRed-loxP-Cited2-3HA-Puro-WPRE plasmid (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: KEAP1-sg1 knockout H1299 (4 x 105) cells were transfected with or without plasmid expressing Halo-KEAP1 (Addgene, a gift from Yimon Aye ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentivirus was produced in 293 cells by co-transfecting the lentiviral constructs with pCMV-dR8.2 (Addgene plasmid #8455) and pCMV-VSV-G (Addgene plasmid #8454 ...
-
bioRxiv - Immunology 2023Quote: ... DC 2.4 cells were transduced using the lentiCas9-Blast vector (Addgene plasmid # 52962; http://n2t.net/addgene:52962; RRID: Addgene_52962) and selected with 10 ug/mL of Blasticidin (AG Scientific #3513-03-9) ...
-
bioRxiv - Microbiology 2024Quote: ... N/Tert-1 Cas9 knockout cells were generated by transduction with a spCas9 lentiviral expression vector (Addgene # 52962) and selecting with blasticidin ...
-
bioRxiv - Bioengineering 2023Quote: ... Lentiviruses were packaged using 293FT cells by co-transfection of lentiviral transfer plasmids with pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Cancer Biology 2023Quote: ... MCF7 CRISPRi were prepared by transduction of MCF7 cells with lentiviral particles produced using vector pMH0001 (Addgene #85969) in the presence of 8 mg/mL polybrene (Sigma) ...
-
bioRxiv - Cancer Biology 2023Quote: ... MCF7 cells were first transduced with lentiviral particles produced using vector pHRdSV40-dCas9-10xGCN4_v4-P2A-BFP (Addgene #60903) in the presence of 8 mg/mL polybrene ...
-
bioRxiv - Cancer Biology 2023Quote: ... Ifngr2−/− and Etv4−/− KPAR cell lines were generated by transient transfection of a Cas9-sgRNA plasmid (pX459, Addgene) generated by standard molecular cloning techniques (see Supplementary Table 3) ...
-
bioRxiv - Biophysics 2023Quote: ... 37] was used to generate the α-catenin DVBS in α-catenin KO cell line (Addgene plasmid 178649).
-
bioRxiv - Microbiology 2023Quote: ... we rescued lentiviral particles by co-transfecting 293T cells with the MKRN2 lentiviral vector alongside d8.74 (Addgene; 22036) and MD2G (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid encoding NPM1-mEGFP was a gift from the Allen Institute for Cell Science (Addgene plasmid # 109122). The sgRNA was synthesized by Synthego with modifications using the protospacer sequence UCCAGGCUAUUCAAGAUCUC (Wienert ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... HEK293T cells were co-transfected with lenti-EF1a-dCas9-KRAB-Puro plasmid (a gift from Kristen Brennand; Addgene_99372) or pLV-dCas9-p300-P2A-PuroR plasmid (a gift from Charles Gersbach ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells (2.5 x 105) were plated in a 6-well plate and transfected with pLenti-BLRR (Addgene # 158958), pLenti-trGluc (Addgene # 158959) ...
-
bioRxiv - Neuroscience 2024Quote: ... 6 × 107 RPE1 cells were infected with the human sgRNA library (Human GeCKO v2 Library Cat#1000000048, Addgene) at an MOI of ∼0.3 ...
-
bioRxiv - Biochemistry 2024Quote: ... cells were transfected 24h after seeding with mammalian expression plasmids to visualize Golgi (EYFP-Golgi7, Addgene plasmids # 56590), using JetPRIME transfection reagent (Polyplus transfection ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were transfected with a mixture of 1.7 μg attB plasmid + 0.2 μg pCAG-NLS-Bxb1 (Addgene#51271) + 0.2 μg pMAX-GFP + 7.8 μL Fugene 6 (for LLP lines ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 200 million K562-Cas9-Blast cells were transduced with each GeCKOv2 library A or B [46] (Addgene #1000000048 or #1000000049 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 293T cells were plated in 10cm plates and transfected using lipofectamine 2000 with 6μg lentiviral pCW57.1-4EBP1_4xAla (Addgene: 38240), 1.5μg pMD2G and 4.5μg psPax2 ...
-
bioRxiv - Molecular Biology 2024Quote: Non-replicating lentiviruses were produced in HEK293T cells using the 2nd generation packaging plasmids psPAX2 construct (Addgene #12260), pMD2.G construct (Addgene #12259) ...
-
bioRxiv - Molecular Biology 2019Quote: ... dCas9-expressing cells were then transduced with the Calabrese Human CRISPR Activation Pooled Library (Set A, Addgene, 92379-LV) using enough cells to obtain a library coverage of 500 cells per sgRNA at an MOI of 0.4.17 Selection with puromycin (0.6 μg/ml ...
-
bioRxiv - Cancer Biology 2021Quote: SPRY2 CRISPR oligonucleotides used in H1299 cells (gRNA target site: GTACTCATTGGTGTTTCGGA) were cloned into pSpCas9(BB)-2A-Puro (Addgene plasmid #62988 ...
-
bioRxiv - Cell Biology 2020Quote: ... a cell line stably expressing Cas9 was generated by infection with lentiCas9-Blast (Addgene 52962, gift from Feng Zhang) and selection with blasticidin ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293 cells were transfected with 4µg pSMPUW-IRIS-Neo-H2BmRFP (Fachinetti Lab) + 4µg pMD2.G (12259 from Addgene, RRID:Addgene_12259) + 4µg psPAX2 (12260 from Addgene ...
-
bioRxiv - Microbiology 2022Quote: ... ACE2-expressing lentivectors were generated via transient co-transfection of HEK293T cells with RRL.sin.cPPT.SFFV/Ace2.IRES-puro (Addgene Plasmid #145839), psPAX2 and VSV-G ...
-
bioRxiv - Molecular Biology 2020Quote: ... this line (148.4) was derived from E14 mouse ES cells and is homozygous for a Tir1-2A-Puro cassette (Addgene plasmid # 92142 ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were transfected with the addressing and packaging plasmids (pCMV delta R8.2, Addgene #12263; pCMV-VSV-G, Addgene #8454). After 48 hours of expression ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were transfected with the addressing and packaging plasmids (pCMV delta R8.2, Addgene #12263; pCMV-VSV-G, Addgene #8454). After 48 hours of expression ...
-
bioRxiv - Molecular Biology 2020Quote: ... These parental BV2 or BV2-Cas9 cells were transduced for 2 d with pXPR_011 lentivirus expressing eGFP (Addgene; 59702) and an sgRNA targeting eGFP at a multiplicity of infection (MOI ...
-
bioRxiv - Molecular Biology 2021Quote: ... The IRE-SunTag reporter was integrated in previously established HeLa cell line stably expressing scFv-GFP (Addgene plasmid: 104998) and NLS-stdMCP-stdHalo fusion protein (Addgene plasmid ...