Labshake search
Citations for Addgene :
1201 - 1250 of 2285 citations for Rat Carboxypeptidase A3 Mast Cell CPA3 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... HEK293T cells were co-transfected with 3 plasmids: pAd-DELTA F6 (plasmid No. 112867; Addgene), serotype plasmid AAV PHP.eB ...
-
bioRxiv - Cell Biology 2023Quote: ... Pitx2-GFP expressing cells were cloned into pLenti PGK Neo DEST (Addgene plasmid # 19067 ref68), EGFP was cloned at the C terminus of the coding sequence of Pitx2 isoform 1 (Origene ...
-
bioRxiv - Cancer Biology 2023Quote: ... MDA-MB-231 cells were transduced with a luciferase lentiviral vector (pHIV-Luciferase, Addgene #21375). Following puromycin drug selection ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 x 105 cells from the previous transfection were transfected with pCMV-PEmax (Addgene: 174820)11 (800 ng ...
-
bioRxiv - Cell Biology 2023Quote: ... All cell lines were generated using the lentivirus Trono group second generation packaging system (Addgene) and selected using puromycin resistance (2 µg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293T cells were co-transfected with transfer plasmids (pCMV-VSV-G and delta8.9, Addgene #8454) and standard packaging vectors using the TransIT-LT1 Transfection Reagent (Mirus ...
-
bioRxiv - Cancer Biology 2023Quote: SUDHL-4 cell line was infected using pLKO.1-puro-GFP U6 sgRNA (Addgene #50920) containing BAX RNA guides or non-targeting RNA guide:
-
bioRxiv - Cancer Biology 2023Quote: ... or Lifr were generated by transducing cells with the plasmid lenticrispr V2 puro (Addgene #98290) cloned with a specific guide ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were transfected with plasmids encoding hNICD3(3xFLAG)-pCDF1-MCS2-EF1-copGFP (Addgene plasmid #40640) or pcDNA3.1(- ...
-
bioRxiv - Immunology 2023Quote: ... Platinum-E retroviral packaging cells were transfected transiently with modified pMIG retroviral plasmids (Addgene, #9044) or a second-generation anti-hCD19 CAR construct (MSCV-myc-CAR2A-Thy1.1 ...
-
bioRxiv - Cell Biology 2023Quote: ... Lentiviruses were produced by transfecting Lenti-X 293T cells with pMD2.VSVG (Addgene plasmid # 12259) and psPAX2 (Addgene plasmid # 12260).
-
bioRxiv - Microbiology 2023Quote: ... cells were co-transfected with 900 ng of the I-SceI plasmid (pCBASceI, Addgene #26477) and 900 ng of pcDNA4/TO-HHV-6B IE1 (+I-SceI ...
-
bioRxiv - Cancer Biology 2023Quote: AW13516 cell lines stably expressing either non-targeting scrambled shRNA (#1864) (Addgene, Cambridge, Massachusetts, USA) or shRNAs targeting C1QBP or TRIM23 were employed to study the effect of knockdown on the tumorigenic potential of cancer cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... These constructs were packed into lentivirus by transient transfection in 293T cells with psPAX2 (Addgene) and the ecotropic MLV envelope pCAG-Eco using calcium phosphate as described (57) ...
-
bioRxiv - Systems Biology 2022Quote: ... 240 million cells were transduced with lentivirus from the Human Genome-wide CRISPRi-v2 (Addgene #83969 ...
-
bioRxiv - Systems Biology 2023Quote: ... All pEN_TT donor vectors were LR recombined with either pSLIK zeo (B2B1 cells; Addgene #25736) or pSLIK neo (TM15c6 cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... ANBL6 cells were infected with lentiviruses carrying pCMV-T7-SpCas9-P2A-EGFP (Addgene, plasmid # 139987) construct and GFP+ cells were selected using FACS.
-
bioRxiv - Cancer Biology 2023Quote: ... CHMp and CHMm cells were transfected with a firefly luciferase gene-carrying plasmid (Addgene #18964) using Lipofectamine 3000 reagent (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... Jurkat cells were co-transfected with Cas9-mCherry (pU6-CBh-Cas9-T2A-mCherry: Addgene 64324) and gRNA-BFP (pKLV2.2-h7SKgRNA-hU6gRNA-PGKpuroBFP ...
-
bioRxiv - Molecular Biology 2023Quote: ... Jurkat cells were co-transfected with Cas9-BFP (pU6-CBh-Cas9-T2A-BFP: Addgene 64323) and gRNA (pSPgRNA ...
-
bioRxiv - Neuroscience 2023Quote: ... lentivirus was used to stably transduced RPE1 cells with either pLX_311-KRAB-dCas9 49 (Addgene #96918 ...
-
bioRxiv - Developmental Biology 2023Quote: ... ASEC-1 cells were transfected with a Cas9 plasmid carrying puromycin resistance (Addgene pSpCas9(BB)-2A-Puro (PX459 ...
-
bioRxiv - Immunology 2023Quote: ... cells were transfected with 500 ng psPAX2 (a gift from Didier Trono, Addgene plasmid #12260), 250 ng VSV-G (a gift from Didier Trono ...
-
bioRxiv - Immunology 2023Quote: All constructs were cotransfected into HEK293T cells with lentiviral packaging vectors psPAX (Addgene cat#12260) and pMD2.g (Addgene cat#12259 ...
-
bioRxiv - Cancer Biology 2023Quote: ... TERT+ cells were transiently transfected with human CA-FOXO1 (pcDNA3 Flag-FKHR-AAA mutant; Addgene) (15) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Stable cell lines were generated with the lentiviral Cas9-blasticidin vector (CRISPR knockout, Addgene, #125592), dCas9-KRAB-blasticidin (CRISPR interference ...
-
bioRxiv - Cell Biology 2023Quote: ... The cells were cotransfected with pCMV-AcGFP1-ORP9-PH and pCHRM1-Tango (Addgene plasmid #66248)70 using PEI-Max at a 1:1 ratio (each 0.5 µg) ...
-
bioRxiv - Cell Biology 2023Quote: ... Lentivirus was produced in HEK293T cells transfected with pMD2.G (Gift from Didier Trono, Addgene plasmid # 12259 containing the VSV-G envelope protein) ...
-
bioRxiv - Biochemistry 2023Quote: ... coli BL21 (DE3) cells using the plasmid pRSFDuet-1/CylLL/CylM-2 (Addgene ID #208759), following the method previously reported.9 For the preparation of lanthionine standard ...
-
bioRxiv - Biophysics 2023Quote: ... HEK293T cells were transfected with transfer plasmid and two helper plasmids psPAX2 (Addgene plasmid #12260) and VSV-G envelope expressing plasmid (pMD2.G ...
-
bioRxiv - Cell Biology 2024Quote: ... Reporter cells were transfected in parallel with pCAGGS-mCherry (a gift from Phil Sharp; Addgene plasmid #41583 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... cells were co-transfected with enveloping (pCMV14-3X-Flag-SARS-CoV-2 S (Addgene #145780) for PVs or pMD2.G (Addgene #12259 ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells that were transfected with a plasmid alone were transfected with GFP-Mapper (Addgene 117721) or C1ORF43-FLAG (SinoBiologic ...
-
bioRxiv - Microbiology 2024Quote: The TR146 cells were transduced with lentivirus that carried the spCas9-Blast construct (Addgene, #52962) at MOI = 0.3 as described above ...
-
bioRxiv - Cell Biology 2024Quote: ... 293FT cells were co-transfected with 1.86 μg psPAX2 (gift from Didier Trono, Addgene #12260), 1 μg VSVG (gift from Bob Weinberg ...
-
bioRxiv - Immunology 2024Quote: All constructs were cotransfected into HEK293T cells with lentiviral packaging vectors psPAX (Addgene cat#12260) and pMD2.g (Addgene cat#12259 ...
-
bioRxiv - Cell Biology 2024Quote: Plasmids used for mammalian cell expression of Eps15 variants were derived from Eps15-pmCherryN1 (Addgene plasmid #27696 ...
-
bioRxiv - Cell Biology 2020Quote: hES cells (H1) were thawed at P29 and transfected with 3.3µM of each hCas9D10A (Addgene #74495), and a gRNA/donor plasmid (pUC_lmnA_Neo_exn1_donor_fixed containing gRNA sequence GCAGGAGCTCAATGATCGCTTGG ...
-
bioRxiv - Immunology 2021Quote: ... TOP10 competent cells were used for all subsequent plasmids except lentiCRISPR v2 (Addgene plasmid no. 52961)43 ...
-
bioRxiv - Cell Biology 2020Quote: ... we transiently transfected MCF7 and SMMC-7721 cells with the Utrophin-GFP reporter (Plasmid #26737, Addgene) using X-tremeGENE HP DNA Ttransfection Reagent (Roche) ...
-
bioRxiv - Developmental Biology 2020Quote: ... HEK293/HEK293T cells stably transduced with the Wnt reporter Super TOP-Flash (STF, Addgene Plasmid #12456) were previously described (Bauer et al ...
-
bioRxiv - Biochemistry 2022Quote: ... these cells were transduced with lentiviral particles for TetO-Fuw empty vector (Addgene plasmid number 85747)(30) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 6cm dishes of cells were transfected with 1ug of guide RNA expressing px300 plasmid (#42230, Addgene) and 1ug of each HDR template/NHEJ PCR product ...
-
bioRxiv - Molecular Biology 2020Quote: ... TbC1 cells were reverse transfected with 400ng of U6>sgRNA plasmids (George Church, Addgene plasmid #41824) according to Table S2 and 3μL Lipofectamin 2000 (Life Technologies) ...
-
bioRxiv - Cell Biology 2022Quote: ... and TAX1BP1 KO HeLa cells were cotransfected with the DNA fragment and the PX459 (Addgene #48139)-based plasmid expressing Cas9 and gRNA (GGGGCCACTAGGGACAGGAT) ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transduced by thermosensitive retroviral gene transfer of SV40 T antigen (LOX-CW-CRE, Addgene) at a MOI of 5 in Proliferation UREC medium with 8μg/mL polybrene (64) ...
-
bioRxiv - Genomics 2020Quote: ... Cells were transfected with 0.5 ug gRNA gblock and 2.5 ug px458 plasmid (Addgene plasmid # 48138) containing spCas9 and GFP ...
-
bioRxiv - Cancer Biology 2020Quote: Cas9-expressing p185+ B-ALL cells were transduced with the Brie CRISPR KO library (Addgene #73633) at a multiplicity of infection of 0.5 with an sgRNA coverage of 400x (24) ...
-
bioRxiv - Neuroscience 2019Quote: ... L cells were transiently transfected with Pi16-tGFP (Origne MG219996) and pm-Turq-ER (Addgene 36204) with Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Immunology 2019Quote: ... cells were transduced with a lentiviral dCas9-HA-BFP-KRAB-NLS expression vector (Addgene plasmid #102244).