Labshake search
Citations for Addgene :
1301 - 1350 of 10000+ citations for Rat FAM24A shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... pTXB1-Tn5 plasmid (Addgene, 60240) was introduced into T7 Express LysY/Iq E ...
-
bioRxiv - Cell Biology 2020Quote: pcDNA3-EGFP (Addgene plasmid #13031) was a gift from Doug Golenbock (UMass ...
-
bioRxiv - Cell Biology 2021Quote: ... Amph1-pmCherryN1 (Addgene plasmid # 27692) and Syndapin2-pmCherryC1 (Addgene plasmid # 27681 ...
-
bioRxiv - Cell Biology 2021Quote: ... CALM-pmCherryN1 (Addgene plasmid # 27691), Amph1-pmCherryN1 (Addgene plasmid # 27692 ...
-
bioRxiv - Cell Biology 2021Quote: ... Epsin2-pmCherryC1 (Addgene plasmid # 27673), CALM-pmCherryN1 (Addgene plasmid # 27691) ...
-
bioRxiv - Biochemistry 2022Quote: ... Ron Vale (Addgene plasmid # 74608).
-
bioRxiv - Cancer Biology 2022Quote: ... plasmids were purchased from Addgene. gBlocks Gene Fragments of skipped β-catenin isoforms for Gibson cloning were synthesized by Integrated DNA Technologies (IDT) ...
-
bioRxiv - Cancer Biology 2022Quote: ... or pLKO.shScramble (Addgene Plasmid #1864) lentiviral vectors ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLKO.shNkx2-1 (Addgene Plasmid #32400) or pLKO.shScramble (Addgene Plasmid #1864 ...
-
bioRxiv - Cell Biology 2022Quote: pPAmCherry1-C1 (Addgene plasmid 31929) was a kind gift of Vladislav Verkhusha (Albert Einstein College of Medicine ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus pAAV.CAG.GCaMP6s.WPRE.SV40 (Plasmid #100844, Addgene) was injected into the plantar area of the hindpaw using a 10 μl Hamilton syringe with a cannula connected to a 30G needle ...
-
bioRxiv - Biochemistry 2022Quote: ... 2G-T (Addgene plasmid #29707), 2GFP-T (Addgene plasmid #29716) ...
-
bioRxiv - Biochemistry 2022Quote: ... 2GFP-T (Addgene plasmid #29716), and co-transformation vector 13S-A (Addgene plasmid 48323) ...
-
bioRxiv - Cell Biology 2022Quote: ... Feng Zhang (Addgene plasmid #62988) using the Gibson Assembly Cloning Kit (NEB) ...
-
bioRxiv - Cell Biology 2022Quote: ... pCAG-enAsCas12a (Addgene plasmid # 107941) (Kleinstiver et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... and pHR_EGFPligand (Addgene plasmid #79129) (Morsut et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... pMaCTag-Z12 (Addgene plasmid # 120055) and pMaCTag-P05 (Addgene plasmid # 120016 ...
-
bioRxiv - Molecular Biology 2022Quote: ... optoPLD-ER (Addgene plasmid # 140060) and optoPLD-ER ‘dead’ (Addgene plasmid # 140059 ...
-
bioRxiv - Genetics 2022Quote: The plasmid Nme2Cas9_AAV (Addgene #119924) was amplified by the primers Nme2Cas9-F/Nme2Cas9-R to obtain the Nme2Cas9_AAV backbone ...
-
bioRxiv - Molecular Biology 2022Quote: ... Lentiviral plasmids pLX303 (Addgene #25897) containing either NSMCE2-WT or NSMCE2-C185S-H187A catalytic dead mutant were generated by Gateway® cloning LR reaction and used to generate stable U2OS cell lines upon 5 µg/mL blasticidin.
-
bioRxiv - Biochemistry 2022Quote: ... David Sabatini (Addgene plasmid #1865), and Mark Howarth (Addgene plasmid #133447) ...
-
bioRxiv - Neuroscience 2022Quote: ... Feng Zhang (Addgene plasmid # 42230). A pair of oligo DNAs corresponding to Casp-gRNA (TTTCCATCATCTCCAGCCAA AGG ...
-
bioRxiv - Cell Biology 2022Quote: ... purchased from Addgene (Plasmid #131471) (Willems et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... a packaging plasmid (psPAX2, Addgene plasmid #12260 was a gift from Didier Trono) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Zhang (Addgene plasmid no. 52962) and cells were selected in medium containing 10μg/ml blasticidin (Gibco ...
-
bioRxiv - Cancer Biology 2022Quote: ... packaging plasmids pVSVg (Addgene, #8454) and pEco (Takara ...
-
bioRxiv - Cancer Biology 2022Quote: ... while EF.CMV.RFP plasmid (Addgene #17619) or pLenti-RFP-Puro (Hölzel ...
-
bioRxiv - Cancer Biology 2022Quote: ... and packaging plasmid psPAX2 (Addgene #12259 and #12260 ...
-
bioRxiv - Cell Biology 2022Quote: ... pmCherry Paxillin (Addgene plasmid #50526) was used as template ...
-
bioRxiv - Cell Biology 2022Quote: ... YFP-STIM1 (Addgene plasmid # 18857)73 ...
-
bioRxiv - Neuroscience 2021Quote: ... Stephen Ekker (Addgene plasmid # 31829). To generate RFamide::NTR-2A-mCherry ...
-
bioRxiv - Neuroscience 2021Quote: ... Harold Burgess (Addgene plasmid # 62213); both GCaMP6s and the 2A peptide used in this paper was derived from AAV-hSyn1-GCaMP6s-P2A-nls-dTomato ...
-
bioRxiv - Cell Biology 2021Quote: ... gRNA_AAVS1-T2 (Addgene plasmid # 41818); 48 ...
-
bioRxiv - Cell Biology 2021Quote: ... William Kaelin (Addgene plasmid #18949).
-
bioRxiv - Microbiology 2020Quote: ... pAdTrack-CMV (Addgene plasmid #16405) and AdEasier-1 cells (Addgene #16399 ...
-
bioRxiv - Biochemistry 2021Quote: ... The following plasmids were obtained from AddGene (AddGene plasmid IDs in parentheses): pcDNA-mcs-BioID2-HA (#74224) ...
-
bioRxiv - Immunology 2020Quote: ... and psPAX2 (Addgene plasmid #12260) at a 2:1:1 ratio ...
-
bioRxiv - Microbiology 2021Quote: ... plasmid pCMV-VSVG (Addgene; # 8454), and transfer vector at 1:1:1 molar ratio using the X-tremeGENE 9 DNA transfection reagent (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2021Quote: ... Plasmids containing EYA2 (Addgene #49264), RUNX1T1 (Addgene #49264) ...
-
bioRxiv - Cell Biology 2021Quote: ... or an mVenus plasmid (Addgene plasmid #27794 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10μg pVSVG (Addgene plasmid #8454) and 10 μg psPAX2 (Addgene plasmid #12260 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Karel Svoboda (Addgene plasmid #28014) (79 ...
-
bioRxiv - Microbiology 2021Quote: ... and psPAX2 (Addgene plasmid #12260) (both gifted from D ...
-
bioRxiv - Neuroscience 2020Quote: pAAV-TRE-EYFP plasmids (Addgene) were packaged as AAV2/9 viruses ...
-
bioRxiv - Neuroscience 2021Quote: ... and psPAX2 (plasmid #12260, Addgene) as described previously (35) ...
-
bioRxiv - Microbiology 2020Quote: ... psPAX2 packaging plasmid (Addgene #12260) and the pVSV envelope plasmid (Addgene #8454 ...
-
bioRxiv - Neuroscience 2020Quote: ... pCAG-CreERT2 (Addgene plasmid #14797) was deposited by Connie Cepko (Matsuda and Cepko ...
-
bioRxiv - Neuroscience 2020Quote: Hes5p-dsRed (Addgene plasmid #26868) was generated by Nicholas Gaiano (Mizutani et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... pCAG-mRFP1 (Addgene plasmid #32600) was deposited by Anna-Katerina Hadjantonakis (Long et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Fox Foundation (Addgene plasmid #51486). The pRK172-mouse α-synuclein-GFP plasmid was a kind gift of Dr ...