Labshake search
Citations for Addgene :
1201 - 1250 of 10000+ citations for Rat FAM24A shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... a pME-Lifeact (65) plasmid was a gift from Rob Parton (Addgene plasmid #109545). Using gateway cloning ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the viral envelope plasmid pMD2.G (gift from Didier Trono; Addgene plasmid # 12259) using Lipofectamine 3000 Transfection Reagent (Invitrogen) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The plasmids pOSIP-TH (Addgene plasmid # 45978 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... lentiMPH v2 (Addgene plasmid #89308) and lenti sgRNA(MS2)_puro backbone (Addgene plasmid #73795)11 were gifts from Feng Zhang.11 ...
-
bioRxiv - Cancer Biology 2021Quote: Cas9-mCherry (Addgene Plasmid #70182) was used to generate stable Cas9-expressing cell lines ...
-
bioRxiv - Cancer Biology 2021Quote: ... pRSV-REV (Addgene Plasmid #12253) and pVSVg (Addgene Plasmid #12259) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pVSVg (Addgene Plasmid #12259). Lentivirus containing supernatants were harvested and transduced into AML cell lines with 4 μg/ml sequabrene (Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2021Quote: ... and psPAX2 (Addgene plasmid 12260) were gifts from Didier Trono ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pSLQ plasmid (Addgene # 51024) cloned with a tRNAIleGAU targeting guide (5’ TGAGCTAACCGGCCGCCCGA 3’) ...
-
bioRxiv - Cancer Biology 2021Quote: ... pMD2.G (Addgene plasmid # 12259) into HEK293T ...
-
bioRxiv - Cell Biology 2021Quote: ... pMXs-Klf4 (Addgene Plasmid #13370), pMXs-c-Myc (Addgene Plasmid #13375 ...
-
bioRxiv - Cell Biology 2021Quote: ... and pCW57.1 (Addgene Plasmid #41393) for periodic overexpression of either Alkbh5 or Alkbh5-HA using LR clonase (Thermo #11791020 ...
-
bioRxiv - Cell Biology 2021Quote: ... pMXs-Sox2 (Addgene Plasmid #13367), pMXs-Klf4 (Addgene Plasmid #13370) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and psPAX2 (Addgene plasmid #12260) were used for transfection using lipofectamine ...
-
bioRxiv - Neuroscience 2020Quote: ... pCXLE-hSK (Addgene Plasmid 27078), and pCXLE-hUL (Addgene Plasmid 27080) ...
-
bioRxiv - Cell Biology 2020Quote: ... the pX459 plasmid (Addgene #62988) was digested with BbsI immediately downstream of the U6 promoter and annealed DNA duplex corresponding to the target sgRNA sequences were ligated ...
-
bioRxiv - Cell Biology 2020Quote: ... the pX459 plasmid (Addgene #62988) was digested with BbsI immediately downstream of the U6 promoter and annealed DNA duplex corresponding to the target sgRNA sequences were ligated ...
-
bioRxiv - Cell Biology 2020Quote: ... Lyn11-FKB (plasmid #20147; Addgene), CFP-FKBP (plasmid #20160 ...
-
bioRxiv - Cell Biology 2020Quote: ... CFP-FKBP (plasmid #20160; Addgene) YF-FKBP-Inp54 (Suh et al ...
-
bioRxiv - Cell Biology 2020Quote: ... Bryan Luikart (Addgene plasmid #75346)50 ...
-
bioRxiv - Cell Biology 2019Quote: ... psPAX2 (Addgene Plasmid: no. 12260), and pCMV-VSV-G-RSV-Rev were co-transfected into Lenti-X 293T cells using polyethylenimine (no ...
-
bioRxiv - Cell Biology 2019Quote: ... pT2ADWpuro_2paRAF (Addgene plasmid: no. 129653) encoding 2paCRY2-RAF1-P2A-CIBN-mScarlet-I-CAAX was described previously30 ...
-
bioRxiv - Cell Biology 2020Quote: ... Toshio Kitamura (Addgene plasmid #13370) (Takahashi and Yamanaka ...
-
bioRxiv - Developmental Biology 2021Quote: ... plasmids were obtained from Addgene. GST-transportin 1 (TNPO1 ...
-
bioRxiv - Neuroscience 2021Quote: ... and pAAV:EF1α:DIO:eYFP (Addgene plasmid #27056) by custom cloning ...
-
bioRxiv - Molecular Biology 2021Quote: ptfLC3 (Addgene plasmid No. 21074) was transfected using lipofectamine 3000 reagent (Invitrogen ...
-
bioRxiv - Biophysics 2020Quote: ... Mito-BFP (Addgene, plasmid #49151) and Dyn2-GFP (gift from Gia Voeltz ...
-
bioRxiv - Biochemistry 2022Quote: ... David Sabatini (Addgene plasmid #11367), Jie Chen & Taekjip Ha (Addgene plasmid #73388) ...
-
bioRxiv - Neuroscience 2021Quote: ... Wilson (Addgene plasmid # 105553; RRID:Addgene_105553). Mice were euthanized 2 months after injection.
-
bioRxiv - Neuroscience 2021Quote: ... Wilson (Addgene plasmid # 105553; RRID:Addgene_105553). Mice were euthanized 2 months after injection.
-
bioRxiv - Neuroscience 2021Quote: ... Viviana Gradinaru (Addgene plasmid # 103005).
-
bioRxiv - Molecular Biology 2020Quote: ... the pKD4 plasmid (Addgene #45605) was amplified by inverse PCR using primers pKD4_F and pKD4_R (Table 1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Feng Zhang (Addgene plasmid # 103862). pCMV-dPspCas13b-FLAG-APEX2-HA (RPL plasmid ...
-
bioRxiv - Cell Biology 2022Quote: ... and psPAX2 (Addgene plasmid #12260) in HEK293T cells using FuGENE HD Transfection Reagent (Promega) ...
-
bioRxiv - Cell Biology 2022Quote: ... and SNAPf (Addgene plasmid # 167271)30 were available in house and used as template plasmids ...
-
bioRxiv - Genomics 2020Quote: ... and pCMVR8.74 (Addgene plasmid #22036) using standard procedures ...
-
bioRxiv - Neuroscience 2020Quote: ... with pAAV.Syn.GCaMP6s.WPRE.SV40 (Addgene Plasmid#100843) as a template (forward primer 5’- TTGACTGCCTAAGCTTgccaccatgcatcatcatcatcatcatg and reverse primer 5’- GATCTCTCGAGCAGCGCTtcacttcgctgtcatcatttgtacaaact ...
-
bioRxiv - Molecular Biology 2019Quote: ... Plasmids containing sgRNAs (Addgene 41824) and a human codon-optimized Cas9 (Addgene 41815 ...
-
bioRxiv - Bioengineering 2019Quote: ... pCMV-BE3 (Addgene Plasmid #73021) was received as a gift from David Liu ...
-
bioRxiv - Immunology 2019Quote: ... with plasmid MLM3613 (Addgene #42251) as a template ...
-
Differential turnover of Nup188 controls its levels at centrosomes and role in centriole duplicationbioRxiv - Cell Biology 2019Quote: ... and pcDNA3.1 mycBioID plasmid (Addgene), respectively ...
-
bioRxiv - Plant Biology 2019Quote: ... pCMV-ABE7.10 (Addgene plasmid #102919) and pCMV-ABE7.9 (Addgene Plasmid #102918 ...
-
bioRxiv - Cancer Biology 2020Quote: ... pCAG-Eco (Addgene plasmid 35617) into 293T cells as described previously (26) ...
-
bioRxiv - Molecular Biology 2019Quote: Plasmid pcDNA3-Clover (Addgene #40259) was used as a base vector for cloning barcodes ...
-
bioRxiv - Cell Biology 2019Quote: ... or mEGFP (Addgene plasmid 87023) inserted at the genomic loci of various proteins ...
-
bioRxiv - Cancer Biology 2019Quote: psPAX2 (packaging plasmid; Addgene#12260), pMD2.G (VSV-G envelope plasmid ...
-
bioRxiv - Physiology 2019Quote: ... and psPAX2 (Addgene plasmid # 12260), which were a gift from Didier Trono ...
-
bioRxiv - Genetics 2019Quote: ... and DR274 (Addgene plasmid #42250) plasmids (gifts from Keith Joung ...
-
bioRxiv - Cancer Biology 2019Quote: ... and pLXSN16E6E7 (Addgene plasmid # 52394). Resulting cell lines were cultivated in K-SFM with 1% (v/v ...
-
bioRxiv - Cell Biology 2019Quote: ... Feng Zhang (Addgene plasmid #62988) [54] (S2D Fig.) ...