Labshake search
Citations for Addgene :
1301 - 1350 of 3904 citations for 6H Dibenzo a g quinolizinium 5 8 13 13a tetrahydro 2 9 dihydroxy 3 10 dimethoxy 7 methyl 7S 13aS since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... PCR products or Plasmids were micro-injected into CB4088 [him-5(e1490)] hermaphrodites with myo-2::mCherry from plasmid pCFJ90 (Addgene) as co-injection marker ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μg psPAX2 (Addgene), and 3 μg pMD2.G (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 (Addgene plasmid #96963)92 ...
-
bioRxiv - Biochemistry 2022Quote: CRISPR-Cas9-mediated gene ablation was carried out using a guide RNA targeting Cmas exon 4 (5’-TGTCGACGAGGCCGTTTCGC-3’) in the plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid #42230 from Feng Zhang) as used before.11 TSC were cotransfected with GFP-expressing plasmid peGFP-CI (Clontech ...
-
bioRxiv - Immunology 2020Quote: ... devil NLRC5 was amplified from pAF105 with overlapping ends to the 5’ and 3’ SfiI sites of the Sleeping Beauty transposon plasmid pSBbi-BH42 (a gift from Eric Kowarz; Addgene # 60515, Cambridge, MA, USA) using Q5® Hotstart High-Fidelity 2X Master Mix (New England Biolabs (NEB) ...
-
bioRxiv - Molecular Biology 2019Quote: ... we designed and generated a CRISPR plasmid targeting the 5′– GTTTGCCCATTACTCTT/CAT(PAM:AGG)–3′ sequence using pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42260, gift from Dr. Feng Zhang), according to a published protocol (Ran et al ...
-
bioRxiv - Immunology 2019Quote: ... HEK293T cells were transfected with the respective sgRNA-containing plasmids together with the VSV-G (pCMV-VSV-G) envelope plasmid and dVPR (pCMV-dR8.2) packaging plasmids (from Addgene) using the XtremeGene9 transfection reagent (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... vector pCMV-VSV-G for expression of the protein G from vesicular stomatitis virus (# 8454) were obtained from Addgene; reporter plasmids pUCHR-inLuc-mR and pUCHR-IR-GFP were described previously 37,38 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Lentiviral particles were produced in 293T HEK cells by co-transfection of the lentiviral pCW57.1_Gata6 plasmid with VSV-G (pMD2.G, Addgene #12259) and helper plasmid (psPAX2 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The viral vectors were generated by transfecting HEK293T cells using polyethylenimine with the packaging vector pCMV-dR8.91 and the vesicular stomatitis virus (VSV-G) envelope expression vector pMD2.G (#12259, Addgene) with either pLenti6.3/V5-DEST-TMPRSS2 (from UH Biomedicum Functional Genomic Unit ...
-
bioRxiv - Cancer Biology 2024Quote: ... 293T cells were co-transfected with lentiCRISPR v2 construct and the second-generation lentiviral packaging plasmids pMD2.G for VSV-G (RRID:Addgene_12259) and pCMVR8.74 for GAG ...
-
bioRxiv - Biochemistry 2019Quote: ... and cloning into linearized pCS2+8 vector (Addgene plasmid #34931). For recombinant expression ...
-
bioRxiv - Neuroscience 2021Quote: ... and AAV2/8-hSyn-DIO-eGFP were obtained from Addgene.
-
bioRxiv - Neuroscience 2021Quote: ... 15μg of pAAV2-8 Rep-Cap plasmid (Addgene plasmid # 112864), and 15μg of pAAV-EF1a-DIO-ChloPhensor ...
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109, Addgene_183127, Addgene_65179, Addgene_183126, Addgene_110593, Addgene_110597), and dsRNA target sequence (Type 3 ...
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109, Addgene_183127, Addgene_65179, Addgene_183126, Addgene_110593, Addgene_110597), and dsRNA target sequence (Type 3 ...
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109, Addgene_183127, Addgene_65179, Addgene_183126, Addgene_110593, Addgene_110597), and dsRNA target sequence (Type 3 ...
-
bioRxiv - Cell Biology 2023Quote: GFP tagged WT Keratin 8 in pEGFP-N3 (Addgene 6080) was kindly provided by Dr ...
-
bioRxiv - Biochemistry 2024Quote: ... mCherry-EB1-8 was a gift from Michael Davidson (Addgene plasmid #55035 ...
-
bioRxiv - Biochemistry 2024Quote: ... were inserted into the pHLmMBP-8 vector (Addgene, cat # 72347)85 using restriction enzymes ...
-
bioRxiv - Immunology 2022Quote: ... a 3’ LTR-restored lentiviral expression vector (Addgene #101337, hereafter LV-3’LTR) expressing a GFP reporter was used to express ACE2 or CD169 ...
-
bioRxiv - Cell Biology 2023Quote: ... Most of the genes related with 14-3-3 were acquired from Addgene and cloned into pMX plasmids ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of pEA216-1 was then co-transfected with 5 μg of the pCMVΔR8.2 helper plasmid (Addgene Plasmid #122263) and 1 μg of pHEF-VSV-G into 70% confluent monolayers of 293T cells in a 10 cm dish using polyethylenimine (Polysciences Inc ...
-
bioRxiv - Cell Biology 2020Quote: New GOLGB1 KO cell lines with mutations in exon 13 were generated using the lentiCRISPRv2 system (lentiCRISPR v2 was a gift from Feng Zhang (Addgene plasmid # 52961 ...
-
bioRxiv - Neuroscience 2022Quote: ... DV: −4.4) we infused 450nL of pAAV5- Ef1a-DIO-(hChR2-E123A)-eYFP (Addgene-ChR2 & eYFP titre: 2.2x10^13 GC/mL)76 ...
-
bioRxiv - Molecular Biology 2022Quote: ... R179A and R320A were PCR amplified and cloned into pET Strep II co-transformation cloning vector (13S-R, Addgene # 48328). Csb3/I-G was cloned into pQE2 (Qiagen ...
-
bioRxiv - Neuroscience 2023Quote: ... University of North Carolina Vector Core) or an enhanced yellow fluorescent protein control (eYFP; N = 13, 6 males; pAAV5-Ef1a-DIO-eYFP, Addgene). Virus (0.2 µl ...
-
bioRxiv - Molecular Biology 2024Quote: The expression vectors encoding truncated AlkB and AlkB D135S (13) pET30a-AlkB and pET30a-AlkB-D135S were a gift from Tao Pan (Addgene plasmid # 79051 ...
-
bioRxiv - Microbiology 2020Quote: ... 9 µg of pLV-eGFP (a gift from Pantelis Tsoulfas (Addgene plasmid # 36083; http://n2t.net/addgene:36083; RRID:Addgene_36083), 9 µg of psPAX2 (a gift from Didier Trono (Addgene plasmid # 12260 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The single vector mammalian expression system containing a CAG promoter-driven St1Cas9 LMD-9 and its U6-driven sgRNA (U6_sgRNA_CAG_hSt1Cas9_LMD9; Addgene plasmid #110626) was built from the above-described plasmids ...
-
bioRxiv - Cancer Biology 2020Quote: ... H357 and SCC-9 cells were transfected with RRBP1 overexpression plasmids pcDNA4 HisMax-V5-GFP-RRBP1(Addgene:Cat#92150) using the ViaFect transfection reagent (Promega Cat# E4982) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The U6-driven sgRNA expression cassettes for St1Cas9 (LMD-9) (v1, v2, v3) (St1Cas9_LMD-9_sgRNA_pUC19; Addgene plasmid #110627) were synthesized as gBlock gene fragments (Integrated DNA Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV-Ef1a-DIO hChR2 (E123T/T159C)-EYFP (gift from Karl Deisseroth, packaged into AAV serotype 9 from Addgene, plasmid # 35509 ...
-
bioRxiv - Microbiology 2022Quote: ... PCDNA3-GFP1-9 T2A mCherry was a gift from Xiaokun Shu (Addgene plasmid # 124430;http://n2t.net/addgene:124430; RRID:Addgene_124430) (PMID ...
-
bioRxiv - Neuroscience 2023Quote: ... We used the following viral constructs and injection volumes per site in the different types of experiments: AAV.9.Syn.Flex.GCaMP6f.WPRE.SV40 (calcium recordings 140 nl; Addgene, no. 100833); AAV.1.hSyn.dio.EGFP (anterograde labelling ...
-
bioRxiv - Neuroscience 2022Quote: ... rAAV2/9 encoding jRGECO1a under control of the human synapsin promoter (4 × 1013 gc/ml; customized from AddGene plasmid #61563 ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293T cells (between passage 9-11) were transfected with lentiviral packaging vector psPAX2 (#12259, Addgene, Watertown, MA, USA), the envelope vector pMD2.G (#12260 ...
-
bioRxiv - Immunology 2022Quote: shRNAs were designed to target human Galectin-9 mRNA and cloned into the pLKO.1 vector (Addgene #10878). The sense shRNA sequences are CCTGGTGCAGAGCTCAGATTT (shGal-9 #1 ...
-
bioRxiv - Immunology 2022Quote: ... RAW 264.7 macrophages were transduced with lentiviral particles containing Gal-9-3xFLAG expressed from pLenti-puro (Addgene #39481). Primary murine bone marrow-derived macrophages (BMMs ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the human codon-optimized Cas9 coding sequence including two nuclear localization signals (SV40 NLS at the 5’ and nucleoplasmin NLS at the 3’) was amplified from hCas9 (Addgene #41815; http://n2t.net/addgene:41815) using primers F_Cas9 and R_Cas9 ...
-
bioRxiv - Cell Biology 2019Quote: ... mCherry-Golgi-7 was a gift from Michael Davidson (Addgene plasmid: no. 55052) and the cassette was subcloned into a pCSIIbsr vector ...
-
bioRxiv - Cell Biology 2021Quote: Mito-Emerald (mEmerald-Mito-7) was a gift from Michael Davidson (Addgene #54160) 43 ...
-
bioRxiv - Biochemistry 2022Quote: pT7-7 WT α-syn construct (Addgene, USA, gifted from Hilal Lashuel [34]), was transformed into BL21-Gold (DE3 ...
-
bioRxiv - Cell Biology 2019Quote: ... The plasmid mAzurite-Actin-7 (a gift from Michael Davidson Addgene plasmid 55227) was modified by incorporating the M2×24 array with 5’ XbaI and 3’ BclI sites ...
-
bioRxiv - Cancer Biology 2019Quote: mTagRFP-T-Fibrillarin-7 was a gift from Michael Davidson (Addgene plasmid # 58016); GFP-Nucleolin from Michael Kastan (Addgene plasmid # 28176 ...
-
bioRxiv - Physiology 2022Quote: ... cells were transfected with 1μg DsRed2-Mito-7 (Mito-dsRed) (Addgene Plasmid #55838) by lipofectamine (Invitrogen L3000008 ...
-
bioRxiv - Cell Biology 2023Quote: ... Soluble mCherry (pmCherry-N3 plasmid) was cloned from pmCherry-mito-7 (Addgene #55102).
-
bioRxiv - Cell Biology 2024Quote: ... gene targeting sgRNAs (Supp Table 7) were cloned into pX459 (Addgene plasmid #48139) using BbsI (NEB ...
-
bioRxiv - Microbiology 2019Quote: ... 2.18 μg of env-defective HIV-1 provirus containing GFP reporter was cotransfected with 0.31 μg pMD2.G VSV G plasmid (Addgene #12259). Simian immunodeficiency virus (SIV)−VLPs containing Vpx were produced by the transfection of 2.18 μg pSIV−Δpsi/Δenv/ΔVif/ΔVpr (Addgene #132928 ...
-
bioRxiv - Cell Biology 2022Quote: Lentiviruses were produced by MaxPEI-based co-transfection of HEK293T cells with the transfer vectors together with the packaging vector psPAX2 and envelope vector pMD2.G (psPAX2 and pMD2.G were a gift from Didier Trono, Addgene plasmid #12259 and #12260 ...