Labshake search
Citations for Addgene :
1451 - 1500 of 3904 citations for 6H Dibenzo a g quinolizinium 5 8 13 13a tetrahydro 2 9 dihydroxy 3 10 dimethoxy 7 methyl 7S 13aS since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: Lentiviruses were produced by MaxPEI-based co-transfection of HEK293T cells with the transfer vectors together with the packaging vector psPAX2 and envelope vector pMD2.G (psPAX2 and pMD2.G were a gift from Didier Trono, Addgene plasmid #12259 and #12260; RRID:Addgene_12259 and RRID:Addgene_12260). Supernatant of packaging cells was harvested 48-72 hrs after transfection ...
-
bioRxiv - Microbiology 2020Quote: ... Vesicular stomatitis virus G protein (VSV-G) pseudotyped lentiviruses expressing human ACE2 were produced by transient co-transfection of pMD2G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Genetics 2020Quote: ... The protocol for lentiviral production was the same as above except we used the common lentiviral pseudotype (VSV-g) using plasmid pMD2.G (Addgene 12259). Transduced cells were selected with hygromycin at 50 ug/mL for Huh7.5-ACE2 and 500 ug/mL for A549-ACE2 for 10 days before use.
-
bioRxiv - Cell Biology 2022Quote: ... each sublibrary pool was co-transfected with third-generation lentiviral packaging plasmids (pVSV-G/MD2.G [Addgene, 12259], pRSV-Rev [Addgene, 12253] and pMDLg [Addgene, 12251]) into low-passage HEK293T cells ...
-
bioRxiv - Microbiology 2022Quote: ... Viruses were produced by transfecting the viral plasmids together with a plasmid encoding VSV-G env (pCMV-VSV-G, kindly provided by Bob Weinberg; Addgene #8454), and in case of the minimal lentiviral vectors ...
-
bioRxiv - Cancer Biology 2022Quote: ... and exon 5: AGCCCAAGGATGCCAGCCAG (guide 2) were ordered from IDT (Leuven, Belgium) and cloned into pSpCas9(BB)-2A-GFP(PX458) (Addgene Teddington, UK), according to the protocol of Ann Ran et al ...
-
bioRxiv - Cancer Biology 2021Quote: ... MOLM-13/Cas9+ cell line stably expressing luciferase was established via lentiviral infection with a Lenti-luciferase-P2A-Neo (Addgene # 105621) vector followed by G418 (1 mg/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... into the AC and a retrograde Cre virus: pENN/AAVrg-hSyn-Cre-WPRE-hGH (1.8E+13 vg/ml, 200nl, Addgene catalog #105553) into the pStr ...
-
bioRxiv - Neuroscience 2023Quote: ... We bilaterally injected Cre-dependent DREADD virus (Roth, 2016): AAV5-hSyn-DIO-hM4D(Gi)-mCherry (2.4E+13 vg/ml, 350nl, Addgene catalog # 44362) or AAV5-hSyn-DIO-mCherry (2.6E+13 vg/ml ...
-
bioRxiv - Molecular Biology 2024Quote: ... we cloned N-terminally StrepII-tagged JetA (C36A, C355A) and untagged JetB into UC Berkeley Macrolab vector 13S-A (Addgene # 48323). To generate truncated JetA constructs ...
-
bioRxiv - Neuroscience 2024Quote: ... Pulled injection pipettes were beveled and back-filled with mineral oil before being loaded with one or more of the following: AAV1-Syn-ChrimsonR-tdTomato (Chrimson, 2.10e+13 gc/mL, 250 nL, Addgene #59171-AAV1), AAV5-Syn-FLEX-rc [ChrimsonR-tdTomato] (FLEX-Chrimson ...
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and our previously verified sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN120 from pLentiCRISPRv2 (Addgene #52961; a gift from Feng Zhang) via lentiviral transduction ...
-
bioRxiv - Physiology 2021Quote: ... Adeno-associated viruses with a null vector (Addgene, AV-8-PV0148) were used as controls.
-
bioRxiv - Cell Biology 2023Quote: ... Wild type Keratin 8 was cloned into pGEX-6p-1 (Addgene) (WT-K8-GST ...
-
bioRxiv - Biophysics 2023Quote: ... a pCDFDuet-1 plasmid containing His6-PPX-nsp7/8 (Addgene: 159092) was transformed into E ...
-
bioRxiv - Neuroscience 2021Quote: ... We bilaterally injected 368 nl of AAV2/9 hSyn.hChR2(H134R).eYFP.WPRE.hGH (UPenn Vector Core) or AAV2/9 CaMKII.ArchT-GFP (UNC Vector Core) or pGP-AAV-syn-jGCaMP7f-WPRE (Addgene) to the LEC or MEC ...
-
bioRxiv - Microbiology 2021Quote: ... the TEV FlipGFP plasmid PCDNA3-FlipGFP(TEV cleavage seq) T2A mCherry (Addgene, #124429, a gift from Xiaokun Shu [9]) was used as a template for pairs of PCR reactions including primers designed to generate overlapping products replacing the TEV cleavage site with the indicated cleavage sequence (S9 Table) ...
-
bioRxiv - Neuroscience 2022Quote: ... we injected either rAAV2/9 encoding GCaMP6s (Chen et al., 2013) under control of the CaMKII promoter (1.25 × 1013 gc/ml; AddGene viral prep #107790-AAV9 ...
-
bioRxiv - Neuroscience 2022Quote: ... or rAAV2/9 encoding for NIR-GECO2 under control of the synthetic CAG promoter (0.5 × 1012 -1 × 1013 gc/ml; AddGene plasmid #159603 ...
-
bioRxiv - Neuroscience 2022Quote: ... PV mice (n=9) were infused with AAV9-CAG-FLEX-SomArchon-GFP (titer: 6.3×1012 – 1.1×1013 GC/mL, Addgene #126943) or AAV9-synapsin-FLEX-SomArchon-GFP (titer ...
-
bioRxiv - Cell Biology 2020Quote: ... and pT7-7 α-Syn A53T (Addgene plasmid #10572737; http://n2t.net/addgene:105727; RRID:Addgene_105727) (gift from Hilal Lashuel).
-
bioRxiv - Neuroscience 2022Quote: ... we injected AAV1-CAG-FLEXFRT-ChR2(H134R)-mCherry (75470, 7×1012 vg/mL, Addgene). For imaging DA dynamics ...
-
bioRxiv - Biophysics 2022Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920 ...
-
bioRxiv - Cell Biology 2019Quote: ... mEmerald-Vimentin-7 and F-tractin-EGFP were gifts from Michael Davidson (Addgene; 54299) and Dr ...
-
bioRxiv - Biophysics 2022Quote: ... mApple-Lifeact-7 (denoted Lifeact-mApple here) was a gift from Michael Davidson (Addgene plasmid # 54747 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Nslmb-vhhGFP4 coding sequence was amplified from pcDNA3-NSlmb-vhhGFP4 (Addgene plasmid #35579, (7)) by PCR and cloned into pCS2+ plasmid by Gibson assembly.
-
bioRxiv - Cell Biology 2020Quote: Plasmids for the expression of recombinant α-Syn were: pT7-7 α-Syn (Addgene plasmid #3604636 ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid # 54920 ...
-
bioRxiv - Neuroscience 2021Quote: ... or AAV5-hSyn-eGFP (titer ≥ 7×1012 vg/mL; Addgene viral prep #50465-AAV5) as control ...
-
bioRxiv - Microbiology 2022Quote: Several plasmids were a kind gift from Nevan Krogan [7] (ORF8-Strep (Addgene #: 141390), Spike-Strep ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920 ...
-
bioRxiv - Bioengineering 2023Quote: ... An existing plasmid was used for the expression of all 7 chaperones (Addgene #197589). For generating the DRUM or DRUMmut stable cell lines ...
-
bioRxiv - Neuroscience 2023Quote: ... Approximately 0.2uL of pAAV5-hSyn-hM4D(Gi)-mCherry (≥ 7 x 1012vg/mL, Addgene # 50475), pAAV5-hSyn-mCherry (≥ 7 x 1012vg/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV-hSyn-DIO-mCherry (400 nl at titer 7×1012, Addgene, #50459-AAV5) as control ...
-
bioRxiv - Microbiology 2021Quote: ... 3 μg of the resulting covalently closed circular DNA was directly co-transfected with 330 ng of pHEF-VSV-G (Addgene Plasmid #22501) into 70% confluent monolayer of 293T cells in a 10 cm dish using polyethylenimine (Polysciences Inc ...
-
bioRxiv - Cell Biology 2021Quote: ... was generated by subcloning the GFP-LC3-RFP-LC3∆G-IRES-PuroR cassette from pMRX-IP-GFP-LC3-RFP-LC3∆G (a gift from Noboru Mizushima and Addgene plasmid # 84572) to a lentiviral backbone downstream of a CAG promoter.
-
bioRxiv - Pathology 2020Quote: ... Lentiviral vector pLV-mCherry and vesicular stomatitis virus glycoprotein (VSV-G) expression vector pMD2.G were obtained from Addgene (Watertown, MA, USA). Coding sequence of SARS-CoV-2 S gene (GenBank ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The MPRA library was co-transfected with third generation lentiviral plasmids (pMDL-g/pRRE, pRSV-Rev, pMD2.G; Addgene #12251, #12253 #12259) using Lipofectamine 3000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were co-transfected using the PEI method with the lentiviral expression vector and two 2nd generation lentiviral packaging vectors: pMD2.G expressing the VSV-G envelope gene (Addgene plasmid 12259) and pCMVR8.74 expressing the gag/pol genes (Addgene plasmid 22036) ...
-
bioRxiv - Genetics 2021Quote: ... pMD2.G was a gift from Didier Trono (Addgene plasmid # 12259 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.25 µg pCMV-VSV-G (Addgene plasmid no. 8454), 2.25 µg psPAX2 (Addgene plasmid no ...
-
bioRxiv - Immunology 2019Quote: ... and lentivirus envelope vector VSV-G (Addgene plasmid #8454). We used the resulting virus particles to transduce immortalized wild-type C57BL/6 cells that express doxycycline-inducible SpCas9 enzyme (generated using Addgene plasmid #50661) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 1.5μg pCMV-VSV-G envelope plasmid (Addgene, 8454). Lentiviral supernatant was harvested at 48 hours post-transfection and passed through a 0.45μm syringe filter (Pall ...
-
bioRxiv - Cell Biology 2020Quote: ... and pMD2.G (a gift from Didier Trono, Addgene plasmid # 12259 ...
-
bioRxiv - Neuroscience 2020Quote: ... with two package plasmids: pCMV-VSV-G (Addgene, #8454) and pCMV-dR8.2 dvpr (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... and pMD2.G plasmid (Addgene. Watertown, MA, plasmid 12259) deposited by Dr ...
-
bioRxiv - Neuroscience 2021Quote: ... and envelope expressing plasmid pMD2.g (Addgene, cat. #12259) were used to transfect Lenti-X cells by CaPO4 precipitation [25 ...
-
bioRxiv - Cell Biology 2021Quote: ... A mixture with 1 µg VSV-G (Addgene, 8454), 1 µg psPAX2 (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... pmNeonGreenHO-G was a gift from Isei Tanida (Addgene plasmid # 127912 ...
-
bioRxiv - Cell Biology 2021Quote: ... and 0.8 μg pMD2.G envelope plasmid (Addgene; #12259) using FuGENE 6 (Promega ...