Labshake search
Citations for Addgene :
1101 - 1150 of 3904 citations for 6H Dibenzo a g quinolizinium 5 8 13 13a tetrahydro 2 9 dihydroxy 3 10 dimethoxy 7 methyl 7S 13aS since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... mRuby-Lifeact-7 was a gift from Michael Davidson (#54560, Addgene). One day after transfection ...
-
bioRxiv - Neuroscience 2020Quote: ... AAVrg-Ef1α-mCherry-IRES-Cre (Titer ≥ 7×1012 vg.mL−1, Addgene). Cholera Toxin Subunit B (Recombinant) ...
-
bioRxiv - Neuroscience 2020Quote: rAAV5-hSyn-hChR2(H134R)-eYFP (Titer ≥ 7×1012 vg.mL−1, Addgene), rAAV5-hSyn-Jaws-KGC-GFP-ER2 (Titer ≥ 3.8×1012 vg.mL−1 ...
-
bioRxiv - Neuroscience 2020Quote: ... rAAV5-hSyn-hChR2(H134R)-mCherry (Titer ≥ 7×1012 vg.mL−1, Addgene), rAAV5-Ef1α-DIO-hChR2(H134R)-eYFP (Titer ≥ 4.2×1012 vg.mL−1 ...
-
bioRxiv - Cell Biology 2020Quote: ... and EBFP2-Nucleus-7 (Addgene #55249, a gift from Michael Davidson). The targeting sequences for the nucleus ...
-
bioRxiv - Cell Biology 2020Quote: ... and mCherry-Cx43-N-7 were gifts from Michael Davidson (Addgene plasmids # 55112 ...
-
bioRxiv - Cell Biology 2022Quote: ... mCherry-Lifeact-7 was a gift from Michael Davidson (Addgene, 54491).
-
bioRxiv - Cell Biology 2022Quote: ... The mCherry-EB3-7 vector was obtained from Addgene (addgene #55037) and the mCherry was removed and replaced by a GFP sequence using AgeI/BsrG1 restriction enzymes ...
-
bioRxiv - Neuroscience 2023Quote: ... mKeima-Red-Mito-7 was a gift from Michael Davidson (Addgene plasmid # 56018 ...
-
bioRxiv - Neuroscience 2022Quote: ... or AAV2retro-CaMKIIa-stGtACR2-FusionRed (Addgene 105669, 7 × 1012 VG/ml) were made unilaterally into right spinal cord gray matter at C7/C8 (0.5 mm lateral ...
-
bioRxiv - Neuroscience 2021Quote: ... under a flex promoter was obtained from the University of Pennsylvania Vector Core (AAV2/9.Syn.Flex.GCaMP6f.WPRE.SV40, CS0641, Penn Vector Core via Addgene). Lateral septum viral injections were targeted at the following coordinates ...
-
bioRxiv - Microbiology 2020Quote: ... CRISPR/Cas-9 vectors were derived from the plasmid lentiCRISPRv2 (a gift from Feng Zhang; Addgene plasmid # 52961 ...
-
bioRxiv - Immunology 2019Quote: ... GXMR-CAR containing the lentiviral vectors pMD2.G (VSV-G envelope-expressing plasmid; Addgene; cat. no. 12259) and psPAX2 (second-generation lentiviral packaging plasmid ...
-
bioRxiv - Microbiology 2022Quote: Hela-H1 cells were transfected with a plasmid encoding the VSV-G gene (pMD2.G; Addgene #12259) using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2021Quote: ... The mEmerald-VSV-G (mEm.-VSV-G) coding construct was a gift from Michael Davidson (Addgene, 54307); pcDNA-D1ER coding for an ER targeted enhanced CFP was a gift from Amy Palmer & Roger Tsien (Addgene cat ...
-
bioRxiv - Cell Biology 2022Quote: ... each sublibrary pool was co-transfected with third-generation lentiviral packaging plasmids (pVSV-G/MD2.G [Addgene, 12259] ...
-
bioRxiv - Immunology 2023Quote: ... 0.5 µg of a plasmid encoding the vesicular stomatitis virus G protein (pMD2.G, Addgene plasmid #12259), 0.25 µg of a plasmid encoding for the transactivating protein Rev (pRSV-Rev ...
-
bioRxiv - Cancer Biology 2023Quote: ... and env-expressing plasmids (pMD2.G and psPAX) using the calcium-phosphate method.30 pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Immunology 2019Quote: ... and pLTR-RD114A(13) (RD114) was a gift from Jakob Reiser (Addgene plasmid#17576; http://n2t.net/addgene:17576; RRID:Addgene_17576). The Measles virus (MV-LV ...
-
bioRxiv - Neuroscience 2019Quote: ... 5.2×1012 gc/ml) and AAV2/5-hSyn-DIO-hM3Dq-mCherry (7.8×1012 gc/ml) were produced from Addgene plasmids #44362 and #44361 at the facility of Nantes University (UMR 1089 ...
-
bioRxiv - Molecular Biology 2021Quote: ... of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665). A CHIP plasmid78 was a gift from Leonard Petrucelli and the CHIP ORF was cloned into pCMV-C2-6myc ...
-
bioRxiv - Molecular Biology 2021Quote: ... Laccase2 Exons 1-3 (Hy_pMT Laccase2 Exons 1-3; Addgene #91799), and nLuc (Hy_pMtnA nLuc SV40 ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-Galectin-3 was subcloned from ptf-Galectin-3 (Addgene: 64149). pMXs-puro eGFP-p62 was a gift from Noboru Mizushima (Addgene plasmid # 38277 ...
-
bioRxiv - Cancer Biology 2019Quote: CXCR4 shRNA Sequence: 5’CCGGTCCTGTCCTGCTATTGCATTACTCGAGTAATGCAATAGCAGGACAGGATTTTTG 3’ was cloned into the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat no. 10878) between unique AgeI and EcoRI sites downstream of the U6 promoter ...
-
bioRxiv - Neuroscience 2020Quote: ... rv 5’-ATTTTAACTTGC-TATTTCTAGCTCTAAAACAACCATGTTCCG-TATTCAGATGCACCAGCCGGGAATCGAACC-3’) that were cloned with a single Gibson Assembly reaction in a pCFD6 (Addgene plasmid # 73915; RRID: Addgene_73915) vector [27] which was previously digested with BbsI restriction enzyme.
-
bioRxiv - Cell Biology 2019Quote: ... NOX1 and NOX2 deletion constructs were generated by inserting PCR amplified 5’ UTR and 3’ UTR fragments of the target genes sequentially into backbone vector pFGL821 (Addgene #58223, hygromycin resistance), flanking the HPH (hygromycin B phosphotransferase ...
-
bioRxiv - Cancer Biology 2020Quote: OE19-dCas9-KRAB stable cells were generated by transfecting 1×106 OE19 cells with 7.5 μg Cas9 plasmid with guides targeting the AAVS1 locus (Addgene #42230; 5’-GGGGCCACTAGGGACAGGAT-3’) and 7.5 μg donor plasmid (pAAVS1-Puro-DNR ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV2/8-Syn-dio-mCherry in vCA1 (control, Addgene), hM4Di (AAV2/8-Syn-DIO-hM4DI-mCherry ...
-
bioRxiv - Neuroscience 2022Quote: AAV2/8 hSyn-DIO-mCherry (Addgene, 2.5E13 GC/ml)
-
bioRxiv - Developmental Biology 2023Quote: ... pCS2+8 was a gift from Amro Hamdoun (Addgene plasmid #34931 ...
-
bioRxiv - Genetics 2021Quote: ... Putative enhancers were attached to a pes-10 minimal promoter::HIS-24::mCherry::let-858 3’UTR fragment amplified from POPTOP plasmid (71) (Addgene #34848) by using PCR stitching to create an enhancer reporter which was sequence verified and purified with a PureLink PCR purification kit (ThermoFisher ...
-
bioRxiv - Genetics 2022Quote: ... Enhancer reporters were produced by fusing via PCR stitching these constructs to a pes-10 minimal promoter::HIS-24::mCherry::let-858 3’UTR fragment amplified from the POPTOP plasmid [53] (Addgene #34848). The enhancer reporters were purified with a PureLink PCR purification kit (ThermoFisher ...
-
bioRxiv - Neuroscience 2023Quote: ... 1.0 µL of diluted CaMKII.GCaMP6f (AAV1, diluted 1:3 with dPBS or AAV9, diluted 1:10 with dPBS, Addgene number: 100834) was injected in three locations throughout auditory cortex (1.5 mm from lambda ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 + 3 gRNAs targeting either side of the +3 kb enhancer core region (targeting sequences listed in Supplementary Table 2) were cloned into pX330 vector (Addgene plasmid #42230). mESCs were co-transfected with a mixture of all 6 CRISPR plasmids and a plasmid containing a blasticidin expression cassette for selection ...
-
bioRxiv - Cell Biology 2019Quote: ... was generated by transfecting HEK293T cells with pC13N-dCas9-BFP-KRAB26 and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA-In Stem (VitaScientific) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Clones were generated using oligonucleotide primers listed in Supplementary Table 2-3 to amplify the gene fragment from cDNA and cloned into the vector pJC53.2 (Addgene Plasmid ID: 26536)60 ...
-
bioRxiv - Cell Biology 2023Quote: ... iPSCs were transfected with pC13N-dCas9-BFP-KRAB and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA In-Stem (VitaScientific) ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSCs were transfected with LSD-dCas9-BFP-KRAB and TALENS targeting the human CLYBL safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using transfection reagent ...
-
bioRxiv - Immunology 2024Quote: ... were carried out as following: MaSCs (passage 2-3) were transduced with sgP53 or sgNT cloned into lentiCRISPRv2-puro (Addgene, Plasmid #98290), passaged once ...
-
bioRxiv - Synthetic Biology 2022Quote: ... together with an expression vector for the VSV-G envelope protein (pCMV-VSV-G, Addgene plasmid no. 8454), an expression vector for GAG-Pol-Rev (psPAX2 ...
-
bioRxiv - Microbiology 2022Quote: ... 2.54 ug of the VSV-G expression plasmid pMD2.G (a gift from Didier Trono, Addgene plasmid # 12259), and 6.42 ug of the appropriate helper construct (pHit-CMV-GagPol (55 ...
-
bioRxiv - Cell Biology 2022Quote: pMD2.G (VSV-G lentiviral envelope vector, 12259) and psPAX2 (lentiviral packaging vector, 12260) were obtained from Addgene. pEGFP-C1-LAMP-1 was obtained as a gift from Dr ...
-
bioRxiv - Immunology 2019Quote: ... The pMD2.G (VSV-G) was a gift from Didier Trono (Addgene plasmid#12259; http://n2t.net/addgene:12259; RRID:Addgene_12259) and pLTR-RD114A(13 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lentiviral envelope and packing plasmids pMD2.G and psPAX2 were ordered from Addgene (pMD2.G #12259, psPAX2 #12260). To generate lentiviral particles ...
-
bioRxiv - Microbiology 2021Quote: ... 0.2 μg pCMV-VSV-G (a gift from Dr. Bob Weinberg (Addgene plasmid #8454; http://n2t.net/addgene:8454; RRID:Addgene_8454)) [79] ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and VSV-G envelope (pMD2.G, gift from Didier Trono (Addgene plasmid # 12259; http://n2t.net/addgene:12259; RRID:Addgene_12259)) at a ratio of 1:2:1.2 ...
-
bioRxiv - Cell Biology 2023Quote: ... together with an expression vector for the VSV-G envelope protein (pCMV-VSV-G, Addgene plasmid no. 8454), an expression vector for GAG-Pol-Rev (psPAX2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and the VSV-G envelope expressing plasmid pMD2.G (gift from Didier Trono (Addgene plasmid # 12259; http://n2t.net/addgene:12259; RRID:Addgene_12259)) ...
-
bioRxiv - Physiology 2022Quote: ... Maternal hepatocyte-specific YAP1 deletion was achieved by injecting mice with the adeno-associated virus serotype 8 (AAV8) with the thyroxine-binding globulin promoter (TBG) promoter expressing Cre (AAV8-TBG-Cre virus, Addgene, AV-8-PV1091) via tail vein at a dose of 1×1012 genomic copies/mouse ...
-
bioRxiv - Cancer Biology 2021Quote: ... and envelope plasmid pMD2.G (12259, Addgene). Media was changed 24 hours post-transfection and virus was harvested 72 hours post-transfection ...