Labshake search
Citations for Addgene :
1301 - 1350 of 1731 citations for 1 1' Diethyl 4 4' bipyridinium dibromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... All plasmids that express GFPuv under the control of a phoB promoter were obtained from Addgene (supplemental table 1) 43,46 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 μl and 500 nl of AAV9-hSyn-GRAB-rDA1m (2 x 10^13 vg/ml; Addgene, 140556-AAV9) were injected into the dorsal striatum (AP 0.5 mm ...
-
bioRxiv - Neuroscience 2023Quote: We designed the syt-jGCaMP8s construct by linking the Drosophila synaptotagmin-1 coding sequences and jGCaMP8s (Addgene Plasmid #162380)69 using a GSGSGS linker ...
-
bioRxiv - Genomics 2023Quote: To create dual-enSERT-1 constructs, we used PCR4-Hsp68::lacZ-H11 plasmid (Kvon et al., 2020) (Addgene #139099) and replaced lacZ with eGFP or mCherry fluorescent reporters using Gibson cloning (Gibson et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... we cloned human NDP52 cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_187829). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-NDP52 in E ...
-
bioRxiv - Cancer Biology 2023Quote: ... HEK 293T cells were transfected with either sulfatase 1 or sulfatase 2 expression plasmids or empty vector control derived from pcDNA3.1 (RRID: Addgene_79663) using Lipofectamine 3000 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... We generated monoclonal U2OS cell lines expressing the following fluorescent plasmids: 1) ptfLC3B was a gift from Tamotsu Yoshimori (Addgene plasmid #21074; http://n2t.net/addgene:21074; RRID:Addgene_2107443; 2) pMXs-puro GFP-DFCP1 was a gift from Noboru Mizushima (Addgene plasmid #38269 ...
-
bioRxiv - Cell Biology 2023Quote: ... we cloned human OPTN cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_190191). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-OPTN in E ...
-
bioRxiv - Biophysics 2023Quote: ... pLenti CMV rtTA3 Hygro (w785-1) was a gift from Eric Campeau (Addgene plasmid #26730; http://n2t.net/addgene:26730; RRID: Addgene_26730). pLenti CMV rtTA3 Hygro is called rtTA3 in the next sections.
-
bioRxiv - Immunology 2023Quote: ... a 4-1BB costimulatory domain and the CAR construct utilized for animals R.301-304 additionally expressed EGFRt.23 CARs were encoded by an xHIV plasmid which was co-transfected with an HIV-1 Rev/Tat and VSV-G envelope plasmid (RRID:Addgene_138479) for lentiviral production as previously described.23
-
bioRxiv - Biochemistry 2024Quote: ... isoform 1) was amplified from K562 cDNA and inserted into insect cell expression vector 438-B (Addgene plasmid: 55219) (N-terminal 6x His (His6 ...
-
bioRxiv - Neuroscience 2024Quote: ... we injected 0.3 μL AAVs encoding ChR2(H134R)-eYFP (titer = 1 x 1012 GC/ml, Addgene# 26973, RRID: Addgene_127090) into the layer 5 of medial prefrontal cortex (mPFC ...
-
bioRxiv - Biochemistry 2024Quote: The plasmid encoding full-length human dynein-1 was graciously provided by the Andrew Carter Lab (Addgene plasmid 11903). This plasmid featured the dynein-1 heavy chain fused to an N-terminus for the His-ZZ-SNAPf tag ...
-
bioRxiv - Cell Biology 2024Quote: ... the following cDNA sequences were cloned into pLKO.1 which was a gift from David Root (Addgene plasmid # 10878). by Genscript Corporation:
-
bioRxiv - Cell Biology 2024Quote: shRNA coding sequences were cloned and inserted into 3rd generation transfer plasmid pLKO.1-TRC cloning vector (Addgene #10878) following the Addgene protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... LOX-1 tagged with V5-6×His at the C-terminus (V5-LOX-1) was subcloned into pmScarlet_C1 (plasmid #85042; Addgene) (mScarlet-LOX-1) ...
-
bioRxiv - Neuroscience 2024Quote: ... we injected 0.3 μL AAVs encoding ChR2(H134R)-eYFP (titer = 1 x 1012 GC/ml, Addgene# 26973, RRID: Addgene_127090) into the layer 5 of medial prefrontal cortex (mPFC ...
-
bioRxiv - Neuroscience 2024Quote: ... RCaMP3 was introduced to S1 by AAVs (AAV2/1-CAG-DIO-RCaMP3-WPRE + AAV1-hSyn-Cre.WPRE.hGH (Addgene, #105553-AAV1)) and imaged with two-photon microscopy (Movable Objective Microscope ...
-
bioRxiv - Cancer Biology 2024Quote: ... A 10-μl Hamilton syringe was used to infuse 1 μl of AAV1/Syn-GCaMP6f-WPRESV40 (titer 4.65 × 1013 GC per ml, via Addgene) into the parabrachial nucleus (−5.3 mm anteroposterior ...
-
bioRxiv - Cancer Biology 2024Quote: ... and MHH-ES-1 were transduced with lentiviral Tet-pLKO-puro all-in-one vector system (plasmid #21915, Addgene) containing a puromycin-resistance cassette ...
-
bioRxiv - Physiology 2024Quote: - pLenti CMV Puro DEST (w118-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17452; http://n2t.net/addgene:17452; RRID: Addgene_17452)
-
bioRxiv - Physiology 2024Quote: - pENTR1A no ccDB (w48-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17398; http://n2t.net/addgene:17398; RRID: Addgene_17398)
-
bioRxiv - Neuroscience 2024Quote: The following virus vectors were used for experiments: adeno-associated virus (AAV)1-Syn-Flex-ChrimsonR-Tdtomato (Addgene #62723), AAV2retro-cFos-tTA-pA (Addgene #66794) ...
-
bioRxiv - Neuroscience 2024Quote: ... each mouse was transduced with a cocktail of CRE recombinase-dependent AAV vectors to express Brainbow 3.0 (AAV-EF1a-BbTagBY and AAV-EF1a-BbChT; titers ≥ 1×10¹³ vg/mL; Addgene) 60 under isoflurane anesthesia ...
-
bioRxiv - Neuroscience 2024Quote: ... At P1-P2 pups were anaesthetized with Iso-fluorane and intra-cortically injected with 1 ul of a viral solution containing (AAV-EF1A-Gephyrin.FingR-GFP-CCR5TC – Addgene#125692 and AAV-CAG-tdTomato - Addgene# 59462 ...
-
bioRxiv - Bioengineering 2024Quote: ... D-REPRESS 1 to 6 plasmids were cloned following the same manner with dRfxCas13d amplification from pXR002 (Addgene #109050)24 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The shRNA sequences for GJB3 knockdown were generated via the GPP Web Portal (https://portals.broadinstitute.org/gpp/public/) and subsequently cloned into the lentiviral vector pLKO.1 puro (Addgene, 8453). To study autophagy in GJB3-silenced cells ...
-
bioRxiv - Biochemistry 2024Quote: ... The extracellular ADAM17 pro- and metalloprotease domains (residues 1– 477) were cloned into the pLib vector (Addgene: Plasmid #80610), which includes a 6x HisTag at the carboxyl terminus 76 ...
-
bioRxiv - Biochemistry 2024Quote: ... The pOPINB-M1-di-Ub(G76V)-HOIL-1 fusion plasmid for bacterial expression is available from Addgene (Plasmid # 229539). Saccharides were purchased from Biosynth Carbosynth (UK) ...
-
bioRxiv - Cell Biology 2024Quote: ... we cloned human OPTN cDNA in a pETDuet-1 vector with an N-terminal 6xHis tag followed by a TEV cleavage site (RRID:Addgene_190191). After the transformation of the pETDuet-1 vector encoding 6xHis-TEV-mCherry-OPTN in E ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transfected with 1 ug each of pSpCas9n(BB)-2A-Puro (PX462) V2.0 and pSpCas9n(BB)-2A-GFP (PX461) (Addgene.org) containing guide RNA sequences for human PANX1 in a 6-well plate ...
-
bioRxiv - Cell Biology 2024Quote: ... The KIF5A-mVenus-iLID was cloned by first substituting the SspB in KIF1A(1-365)-Venus-SspB (Addgene #174635) (Nijenhuis et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... the cytosol-exposed domain of NIX (1-182aa) was fused to a C-terminal GST-tag through cloning into a pET-DUET1 vector (RRID:Addgene_223733). Point mutants were introduced by in vitro mutagenesis to generate NIX E72A/L75A/D77A/E81A (4A ...
-
bioRxiv - Cell Biology 2024Quote: ... the cytosol-exposed domain of BCL2L13 (1-465aa) was fused to a C-terminal GST-tag through cloning into a pET-DUET1 vector (RRID:Addgene_223744). Point mutants were introduced by in vitro mutagenesis to generate BCL2L13 W276A/I279A (ΔLIR1 ...
-
bioRxiv - Cell Biology 2024Quote: ... the cytosol-exposed domain of FUNDC1 (1-50aa) was fused to a C-terminal GST-tag through cloning into a pET-DUET1 vector (RRID:Addgene_223734). Point mutants were introduced by in vitro mutagenesis to generate FUNDC1 Y18A/L21A (ΔLIR ...
-
bioRxiv - Cell Biology 2024Quote: ... TRIM24 shRNAs (C1 and C2) were cloned into the pLKO.1 TRC vector according to the protocols from Addgene.
-
bioRxiv - Cell Biology 2024Quote: shRNA sequences were designed using BLOCK-iT™ RNAi Designer and cloned into the pLKO.1 vector (Addgene #8453). The vector was digested with AgeI (Abclonal ...
-
bioRxiv - Developmental Biology 2024Quote: shRNA sequences were designed using BLOCK-iT™ RNAi Designer and cloned into the pLKO.1 vector (Addgene #8453). The vector was digested with AgeI (Abclonal ...
-
bioRxiv - Genetics 2024Quote: ... Histones H3.1 and H3.1K27M (aa 1-136) were inserted into the Gateway destination vector pGWB-nLUC (Addgene Plasmid #174050). Agrobacterium tumefaciens GV3101 strains harboring these constructs were introduced into the leaves of 4-week-old Nicotiana benthamiana plants ...
-
bioRxiv - Cell Biology 2024Quote: ... were recombined into intron 1 of the mouse Rosa26 locus using the targeting vector STOP-eGFP-ROSA26TV (Addgene #11739)56 ...
-
bioRxiv - Cancer Biology 2021Quote: ... HT-1080N cells were transduced with lentiviruses carrying the reverse tetracycline-controlled transactivator 3 under a CMV promoter (CMV-rtTA3) (Cat# w756-1, Addgene). HT-1080N-rtTA3 cell lines were selected in 10 μg/mL blasticidin (Cat # A1113902 ...
-
bioRxiv - Cancer Biology 2021Quote: The lentiviral constructs encoding mKO2-SLBP(18-126) and Clover-Geminin(1-110) were a gift from Michael Lin (Addgene plasmid # 83915 ...
-
bioRxiv - Cell Biology 2020Quote: ... Nsp1-NT (1-127 aa) and Nsp1-CT (128-180 aa) were amplified from pDONR207 SARS-CoV-2 NSP1 (Addgene) by PCR and then cloned into pDB-His-MBP or BacMam pCMV-Dest plasmid ...
-
bioRxiv - Cell Biology 2020Quote: ... and further subcloned into a CMV driven vector (pLenti CMV V5-LUC Blast (w567-1) was a gift from Eric Campeau (Addgene plasmid #21474 ...
-
bioRxiv - Cell Biology 2020Quote: Pairs of CRISPR guide RNA oligos (mouse Chmp5 single guide RNAs [sgRNAs] targeting GGCTCCGCCACCTAGCTTGA and GTTTCGCTTTTCCGAAGAAT on exon 1 respectively) were annealed and cloned into the BsmBI sites of lentiCRISPR V2-puro vector (plasmid 52961, Addgene). CRISPR lentiviral plasmids and lentiviral packaging plasmids (pMDLg/pRRE ...
-
bioRxiv - Immunology 2021Quote: ... a human RNH1-full coding sequence (ORIGEN RC 200082) insert was cloned into the entry vector pENTR4-GFP-C1 (W392-1, Addgene) and then recombined into the destination vector pLenti CMV Blast DEST (706-1 ...
-
bioRxiv - Immunology 2021Quote: RNH1-KO THP1 cells were infected with lentiviruses expressing RNH1 (pLenti CMV Blast GFP-RNH1) or the empty vector pLentiCMV-GFP-Blast (659-1, Addgene) as previously described (Papin et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... to co-transfect pBABE-puro or pBABE-puro.SLX4IP.3xFLAG with pCMV-VSV-G (at a ratio of 6:1, Addgene#8454) into GP2-293 cells (Clontech) ...
-
bioRxiv - Bioengineering 2022Quote: ... sgRNA cassette) were PCR-amplified and recloned into 2 lentiviral plasmids (pLKO.1 neo, Addgene #13425; pLJM-EGFP, Addgene #19319) and ...
-
bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...