Labshake search
Citations for Addgene :
1551 - 1600 of 1731 citations for 1 1' Diethyl 4 4' bipyridinium dibromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... The HTR8 cells with mir-218 KO were generated by cloning gRNAs that target mir-218-1 and mir-218-2 into a CRISPR/Cas9 vector PX459 (Addgene #62988). The plasmid was verified by sequencing ...
-
bioRxiv - Biochemistry 2024Quote: ... pEGFP-C1-tagged plasmids containing the exon 1 of HTT with 23 CAG repeats (GFP-Q23: wild-type HTT. Addgene, #40261) or 74 CAG repeats (GFP-Q74 ...
-
bioRxiv - Cell Biology 2024Quote: ... control or mir-218-1-overexpressing HTR8 cells were seeded into 12-well plates and were co-transfected with 1 µg/mL of 5X NFκB luciferase reporter (64) (Addgene plasmid #12453) construct and 20 ng/mL of Renilla luciferase vector (Promega ...
-
bioRxiv - Cancer Biology 2024Quote: ... ALKBH5 shRNA was generated by ligation of oligonucleotides into the AgeI and EcoRI restriction sites of pLKO.1 (Addgene plasmid #8453). Lentiviral-shRNA particles were generated by transfecting HEK 293T cells with 12 μg of pLJM1 vector containing the shRNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... reporter cell lines were generated by TALEN-mediated homology-directed repair to integrate enhancer reporter donor constructs into the AAVS1 locus by electroporation of 1 × 106 K562 cells (or K562 cells selected to have the desired synthetic transcription factor) with 1 ng of reporter donor plasmid and 0.5 ng of each TALEN-L (Addgene no. 35431) and TALEN-R (Addgene no ...
-
bioRxiv - Neuroscience 2024Quote: ... we used OT-IRES-Cre pups injected at P0 into the PVN with a Cre-dependent rAAV2/1 vector expressing eOPN3 (pAAV-hSyn1-SIO-eOPN3-mScarlet-WPRE; Addgene #125713).
-
bioRxiv - Cancer Biology 2024Quote: ... generated by transduction of MDA-MB-231 (named in short MB-231) with lentiviral vectors carrying pLKO.1 plasmid (Addgene, 8453) cloned with shANP32E-808 (sh sequence ...
-
bioRxiv - Cancer Biology 2023Quote: Engineering of Luc-tagged HCC1954 cells (HCC1954-Luc) and tumour implantation: the pLenti CMV Puro LUC (w168-1) was purchased from Addgene (#17477) and used in all in vivo experiments ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing 10% FBS and 1% penicillin-streptomycin, and equal amounts of plasmids (250 ng of each: luciferase reporter, actin-GAL4 (Addgene #24344), one dCas9-Rb constructs ...
-
bioRxiv - Neuroscience 2023Quote: ... To express the calcium indicator GCaMP6s in neuronal cell bodies or long-range projection axons either AAV5-Syn-GCaMP6s or AAV1-Syn-GCaMP6s (1−1013 gc/mL; Addgene #100843) was injected into the relevant brain region ...
-
bioRxiv - Neuroscience 2023Quote: ... PV-cre mice received unilateral injections in the left lobule simplex of 0.7 µl of pAAV-1-hSyn1-Flex-SIO-stGtACR2-FusionRed-dlox (N = 5, 2.0 × 1012 genome copies/mL; Addgene: 105677-AAV1), while another group of PV-cre mice received injections of pAAV-9/2-hSyn1-dlox-tdTomato-dlox-WPRE (N = 3 ...
-
bioRxiv - Cancer Biology 2022Quote: ... the shRNA sequences (5′-CTCATTTAGCAGACATCGCAA-3′ (shRNA-1) and 5′-CTTTACTAGGAGACGCCAATA-3′ (shRNA-2) (Zhang et al, 2012b)) were inserted into EZ-Tet-pLKO-Puro vector (Addgene, 85966), respectively ...
-
bioRxiv - Cell Biology 2022Quote: ... listed in Supplementary Table 1) were cloned into the BsmBI restriction site of the Lenti-Cas9-gRNA-TagBFP2 vector (Addgene 124774) and packaged in 293T cells by co-transfection with pMD2.G (Addgene 12259 ...
-
bioRxiv - Neuroscience 2022Quote: ... In earlier experiments AAV1:CBA:FLEX:Arch-eGFP (200nl;5.48x1012 vg/ml; AV-1- PV2432; University of Pennsylvania vector core, Philadelphia, PA, USA, now at Addgene, 22222 - AAV1) was used ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP1-10 plasmid (pHAGE2-EF1a-GFP1-10-IRES-Puro) was generated by cloning GFP1-10 from pcDNA3.1-GFP(1-10) (Addgene Plasmid #70219) into a lentiviral vector that contains EF-1α promoter and Puromycin selection marker ...
-
bioRxiv - Cancer Biology 2022Quote: ... shRNA clones harboring a blasticidin-resistance gene were generated by cloning validated oligonucleotides into the EcoRI/AgeI sites of pLKO.1-Blast (Addgene, #26655). Gene-specific shRNA lentiviral vectors with a pLKO.1 backbone were purchased from Sigma-Aldrich.
-
bioRxiv - Biochemistry 2022Quote: ... expression plasmid was cloned by PCR amplification from full length ScTop2 12URA-B vector followed by insertion into a modified 1-B (Addgene #29653) E ...
-
bioRxiv - Cell Biology 2022Quote: ... reporter under the constitutive elongation factor 1-α (EF1α) promoter and upstream of a P2A linker followed by the tdTomato fluorescent protein (gift from Kazuhiro Oka;Addgene plasmid #72486 ...
-
bioRxiv - Cell Biology 2022Quote: ... were amplified using primers containing overhangs with the homology sites for GMAP cloning and inserted into a lentiviral vector (LV 1-5; Addgene, 68411). IL6-EGFP from pmIL-6promoterEGFP (Addgene 112896) ...
-
bioRxiv - Genetics 2022Quote: ... sgRNA oligos with BbsI sticky ends (IDT, 25nmole standard desalted, Supplementary Table 1) were ligated into the pDG459 plasmid (Addgene 100901) as previously described 45 ...
-
bioRxiv - Neuroscience 2022Quote: ... we cloned the dgn-1 promoter and AcNPV p10 3’UTR into the vector pPD49.26 (from the Andrew Fire plasmid kit, Addgene Kit #1000000001) to generate plasmid pNTC2 ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV plasmids carrying either cDNA for respective genes downstream of a CMV promoter were co-transfected with pAAV2/1 (Addgene #112862) encoding the AAV genes rep and cap ...
-
bioRxiv - Plant Biology 2023Quote: ... All four Level 1 cassettes were assembled in a one-step reaction into the Level 2 acceptor plasmid (pAGM4723 Addgene #48015) as previously described (Dudley et al. ...
-
bioRxiv - Plant Biology 2023Quote: ... The final construct was assembled by combining the two Level 1 sgRNA cassettes with cassettes for resistance to kanamycin pICSL11024 (Addgene#51144) and constitutive expression of SpCas9 (pEPQD1CB0001 ...
-
bioRxiv - Genomics 2022Quote: sgRNA-CRISPR library targeting 550 chromatin regulators (Suppl Table 1) was ordered from IDT Technologies and cloned using Gibson assembly in CRISP-seq backbone (Addgene #85707). The Gibson assembly product was electroporated in Endura ElectroCompetent cells following the manufacturer’s protocol (Endura #60242-2 ...
-
bioRxiv - Biochemistry 2022Quote: ... Immobilized proteins were eluted by incubation with 1 mL of 250 nM SENPEuB protease (expressed and purified from pAV286 (Addgene # 149333))74 overnight at 4° C ...
-
bioRxiv - Cancer Biology 2023Quote: The lentivirus shRNA plasmids targeting mouse RelA and Pkci were generated by cloning annealed oligos into AgeI and EcoRI sites of pLKO.1-hygro-ctrl plasmid (Addgene #24150). Following target sequences and oligos were utilized ...
-
bioRxiv - Cell Biology 2022Quote: ... the PCR-amplified fragment of pie-1p::gfp::PH::pie-1 3’UTR was inserted into pCFJ1662 (a gift from Erik Jorgensen, Addgene #51482). Plasmid mixtures containing pCFJ1662_PH ...
-
bioRxiv - Developmental Biology 2023Quote: ... shortened to 19 bp length and flanked with BbsI overhangs. Corresponding oligonucleotides (Suppl. Table 1) were inserted into BbsI-digested pX330-U6- Chimeric_BB-CBh-hSpCas9 (obtained from Addgene, plasmid #42230) 35 to generate pX330- Ep400-Ex15 and px330-Kat5-Ex8 ...
-
bioRxiv - Microbiology 2023Quote: ... HUDEP-2 were transduced at an MOI <1 with lentivirus prepared from pXPR_101 (lentiCas9-blast, gift from Feng Zhang, Addgene plasmid 52962) and selected with blasticidin ...
-
bioRxiv - Cell Biology 2023Quote: ... CFP-GAI-MTM1 was made by inserting MTM1 from mCherry-FKBP-MTM1 after GAI in CFP-GAI(1-92) (gift from Takanari Inoue, Addgene # 37307). LysoYFP-GID1 was made by inserting Lyso from LysoGFP-Sac1 before YFP in YFP-GID1 (gift from Takanari Inoue ...
-
bioRxiv - Neuroscience 2024Quote: ... An intersectional approach was used for selective activation of mPFC to BLA projection using chemogenetics: 1) retrograde AAV encoding FlpO (0.3 μL, titer ≥ 7 x 1012 GC/ml, Addgene# 55637; RRID:Addgene_55637) were bilaterally injected into BLA (A-P ...
-
bioRxiv - Cancer Biology 2024Quote: Guide RNA (gRNA) sequences targeting neutral sphingomyelinases 1 & 2 and Rab27s a and b were cloned into a lentiCRISPR vector (Addgene (52961) 45 ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 × 106 cells were plated in 60 mm dishes for 24 hours followed by transfection with m6A-Tracer GFP (AddGene, 139403) and DAM-lamin B1 (AddGene ...
-
bioRxiv - Immunology 2024Quote: Stable Cas9 expression was established in human B-cell lines (WSU-FSCCL, HBL-1 and SUDHL5) using lentiviral transduction of lentiCas9-Blast (Addgene #52962). Cells were incubated with 10µg/ml polybrene (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... 5% FBS,0.01% Sodium Pyruvate) were transfected according to manufacturer instructions using Lipofectamine 2000 with plasmids carrying HIV-1 Gag/Pol (pMDLg/pRRE Addgene: 12251), HIV-1 Rev (pRSV-Rev Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... mice were stereotaxically injected with an adeno-associated viral vector encoding a double-floxed inverted orientation GCaMP6f (pAAV-Syn-Flex-GCaMP6f-WPRE-SV40, titer: ∼ 1 × 1013 GC/mL, acquired from Addgene (#100833)) using Nanoject III (Drummond Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... The second crystallography construct (P1 21 1 form) was cloned into a pNIC vector with a His Sumo tag (Addgene: 215810) and residues (2 – 170 ...
-
bioRxiv - Microbiology 2024Quote: ... A gene block covering the spike portion of NYU-1 strain was ordered from IDT and cloned into pGSTag plasmid (Addgene, 21877) through Gibson Assembly (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: A non-targeting ‘scramble shRNA’ control sequence and two L1-ORF1-targeting shRNAs [9] were cloned into pLKO.1-TRC (Addgene #10878):
-
bioRxiv - Cell Biology 2024Quote: ... mScarlet-i-PLEKHA5WW was made by inserting the cDNA sequence encoding the tandem WW domain (residue 1-105) into the CMV-mScarlet-i-C1 vector (Addgene 85044) using BamHI and SalI ...
-
bioRxiv - Neuroscience 2024Quote: ... Site-directed integration into attP sites was achieved by co-injection of an attB-containing vector (400 ng µl-1) and pBS130 (encoding ΦC31 integrase under control of a heat shock promoter (Addgene #26290) (Gohl et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... a plasmid with the synapsin-1 promoter that controls the expression of the biosensor GCaMP6 and fused to the red fluorochrome mRuby2 (Addgene, # 50942); and hSyn-HyPer ...
-
bioRxiv - Molecular Biology 2024Quote: ... the sgRNA coding sequence (Supplementary Table 1) was cloned into pX459 V2.0 vector (a gift from Feng Zhang; Addgene plasmid 62988)63 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... with library plasmid amount corresponding to 1 plasmid per cell and 20 ug of base editor pCMV-T7-ABE8e-nSpCas9-P2A-EGFP (KAC978) (Addgene #185910). Genomic DNA was collected from cells 5 days after transfection.
-
bioRxiv - Molecular Biology 2024Quote: ... the rtTA3 gene fused to the blasticidin resistant marker (BlastR) was adapted from the pLenti CMV rtTA3 Blast (w756-1) plasmid (Addgene, 26429).
-
bioRxiv - Neuroscience 2024Quote: ... and two sgRNA targeting sequences against BORCS7 (1: CGCGATTACGTCAGTACCAC, 2: GATTACGTCAGTACCACAGG) were cloned into the lenti-CRISPR v2 plasmid (Addgene 52961) following the Zhang Lab protocol (https://media.addgene.org/data/plasmids/52/52961/52961-attachment_B3xTwla0bkYD.pdf) ...
-
bioRxiv - Plant Biology 2024Quote: ... ONAC024 and SS1/ ONAC025 were amplified using gene-specific primers (Supplemental Table 1) and cloned in pGADT7-GW/pGADT7-AD (Addgene, USA) through Gateway® cloning technology ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV9-hSyn-GRABNE2h was co- injected with AAV9-CAG-tdTomato (stocks at 1-2 x 1013 copies/mL, Addgene, #59462-AAV9).
-
bioRxiv - Microbiology 2024Quote: ... from cDNA obtained from RPE-1 cells and cloned into pReplacer or the tet-on lentiviral vector pLIX-402 (Addgene #41394) using PstI restriction sites ...