Labshake search
Citations for Addgene :
1101 - 1150 of 1731 citations for 1 1' Diethyl 4 4' bipyridinium dibromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Sequences (shPROX1-1: TGCTGTTGACAGTGAGCGCGAGGACCAAGATGTCATCTCATAGTGAAGCCACAGATGTATGAGATGAC ATCTTGGTCCTCATGCCTACTGCCTCGGA; shPROX1-2: TGCTGTTGACAGTGAGCGCCCCCGAGAAAGTTAC AGAGAATAGTGAAGCCACAGATGTATTCTCTGTAACTTTCTCGGGGATGCCTACTGCCTCGGA) were cloned into the LT3GEPIR backbone100 (Addgene; 111177) and used to generate lentiviral particles to transduce into organoids as described99 ...
-
bioRxiv - Developmental Biology 2023Quote: ... CRISPR guide RNAs (gRNAs) targeting exon 1 of SLC25A1 were subcloned into lentiCRISPR v2 (Addgene Plasma 52961) using BbsI sites as described.33,40 Non-targeting guides were generated using previously reported sequences.
-
bioRxiv - Genomics 2022Quote: ... The open reading frames of H3 and H4 were cloned in the Dox-inducible expression vector KA0717 (KA0717_pPB-hCMV*1-cHA-IRESVenus was a gift from Hans Schöler, Addgene plasmid #124168; http://n2t.net/addgene:124168; RRID:Addgene_124168) fused at their 3’ end in frame to the sequence of the yellow fluorescent protein (YFP ...
-
bioRxiv - Developmental Biology 2023Quote: ... nls::Cas9::nls (subcloned from Eef1a-1955/- 1>nls::Cas9::nls a gift from Lionel Christiaen, Addgene plasmid # 59987 ;http://n2t.net/addgene:59987 ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... coding for the large T oncogene SV40 (V40 1: pBSSVD2005 was a gift from David Ron; Addgene plasmid #21826 ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLenti CMV GFP Blast (659–1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17445). pHAGE-PIK3CA-H1047L was a gift from Gordon Mills & Kenneth Scott (Addgene plasmid # 116499 ...
-
bioRxiv - Cancer Biology 2023Quote: ... High complexity barcoding library LARRY Barcode Version 1 library79 was a gift from Fernando Camargo (Addgene #140024). Retroviral stocks were generated using pCL-Eco plasmid ...
-
bioRxiv - Plant Biology 2023Quote: ... fw2.2-sgRNA-1 and fw2.2-sgRNA-2 were fused to the Arabidopsis AtU6-26 promoter (Addgene #46968) by digestion-ligation reaction in plCH47751 (Addgene #48002 ...
-
bioRxiv - Cancer Biology 2023Quote: the NF1 isoform 1 recombinant protein was produced in insect cells starting from the plasmid R702-X38-635 encoding for His6-Hs.NF1opt (1-2839) (a gift from Dominic Esposito; http://n2t.net/addgene:159576; RRID:Addgene_159576) 33 ...
-
bioRxiv - Molecular Biology 2023Quote: shRNA oligonucleotides targeting FEN1(shown in the following table) were cloned into pLKO.1 (Cat# 8453, Addgene) digested with EcoRI and AgeI ...
-
bioRxiv - Plant Biology 2023Quote: ... These two level 1 vectors were assembled with the Kanamycin resistance gene (pNOS::NPTII-OCST; Addgene #51144), the AtCas9 (2×35S::AtCAS9-OCST ...
-
bioRxiv - Microbiology 2023Quote: ... The wild-type (Flag-SIRT1) and mutant (Flag-SIRT1 H363Y) SIRT-1 plasmids were purchased from Addgene and transfected into cells using Lipofectamine 2000 ...
-
bioRxiv - Microbiology 2023Quote: pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 8453; http://n2t.net/addgene:8453; RRID:Addgene_8453)75 ...
-
bioRxiv - Neuroscience 2024Quote: ... Each coverslip was transfected with 1 μg of either GFP or HA-UBE3A plasmid (Addgene, cat. #8648), and 1 μL Lipofectamine 2000 ...
-
bioRxiv - Neuroscience 2024Quote: ... PV-ChR2 mice were injected with 1µl of AAV-CaMK2-GCaMP6f (Addgene, #100834-AAV9, dilution 1/15) at 0.75µl.min−1 in the left primary auditory cortex (centered at 1.75 mm anterior to the inter-section of the lambdoid and interparietal-occipital sutures ...
-
bioRxiv - Neuroscience 2024Quote: ... n=2) or AAV9.EF1a.dflox.hChR2(H134R).EYFP.WPRE.HGH (1×10^12 pp/mL, Addgene, cohort 2, n=2). Subject mice were additionally injected in vCA2 (AP −3.0 ...
-
bioRxiv - Biochemistry 2024Quote: Human interferon-induced protein with tetratricopeptide repeats 1 (IFIT1) gene (Gene ID: 3434) was obtained from Addgene in the plasmid vector pET28a_IFIT1 ...
-
bioRxiv - Plant Biology 2024Quote: ... Binomica Labs) with primers for Golden Gate assembly into the Level 1 pICH47742 plasmid (Addgene catalog # 48001) with a double 35S promoter (pICH51277 ...
-
bioRxiv - Neuroscience 2024Quote: ... DV: -0.4) and 0.3μl of AAV.PHP.eB-CAG-DIO-tdTomato (28306-PHPeB, Addgene, 1×10¹3 vg/mL) was injected at a rate of 0.05μl/min ...
-
bioRxiv - Cancer Biology 2024Quote: ... and EGFP control (See Supplemental Table 1 for sgRNA sequences for each)) into lentiCRISPR v2 (Addgene #52961). For individual gene knockouts pooled libraries of up to four sgRNAs were generated ...
-
bioRxiv - Bioengineering 2024Quote: ... [1] pMDLg/pRRE was a gift from Didier Trono (Addgene plasmid 12251 ; http://n2t.net/addgene:12251 ; RRID:Addgene_12251), and [2] pRSV-Rev was a gift from Didier Trono (Addgene plasmid 12253 ...
-
bioRxiv - Immunology 2024Quote: ... DLD-1 wild type cells were transduced with pLenti-CMV-MCS-RFP-SV-puro (Addgene plasmid #109377) viral particles (DLD-RFP ...
-
bioRxiv - Immunology 2024Quote: ... and proIL-1β were cloned from PMA-differential THP-1 cells and inserted into pCS2Flag (16331, Addgene)-based expression vectors with different tags ...
-
bioRxiv - Biophysics 2024Quote: ... https://www.addgene.org/124929).22 The plasmid for FUS LC (RP1B FUS 1-163) was a gift from Nicolas Fawzi (Addgene plasmid #127192 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and pLenti CMV Puro DEST (w118-1) were gifts from Eric Campeau & Paul Kaufman (Addgene plasmid #17398, http://n2t.net/addgene:17398, RRID:Addgene_17398; Addgene plasmid #17452 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Clover-Geminin(1-110) were a gift from Michael Lin (Addgene plasmid # 83915; http://n2t.net/addgene:83915; RRID:Addgene_83915 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Plasmids to overexpress tRNAIle or with shRNAs targeting tRNAIleGAU were cloned into the plko.1 puromycin (Addgene # 8453) or blasticidin (Addgene #26655 ...
-
bioRxiv - Cell Biology 2020Quote: ... pGEX6P1-human LIC1 G domain (GST-LIC 1-389) was a gift from Ron Vale (Addgene plasmid # 74598; http://n2t.net/addgene:74598; RRID:Addgene_74598) (Schroeder et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA sequences between nucleotides 1-3877 and 4236-4617 were PCR amplified from V5-GFP-P180 (Addgene #92150) and the two fragments were assembled and cloned into pEGFP(A206K)-N1 between XhoI and BamHI sites by GIBSON assembly ...
-
bioRxiv - Cell Biology 2022Quote: ... Plasmid mixes to produce HIV-1 viral particles consisted of 0.4 μg CMV-VSVG (pMD2.G; 12259; Addgene) and 2.6 μg of HIV proviral plasmid ...
-
bioRxiv - Microbiology 2022Quote: ... or pLKO.1-blast (pLKO.1-blast was a gift from Keith Mostov (Addgene plasmid #26655; http://n2t.net/addgene:26655; RRID:Addgene_26655).
-
bioRxiv - Microbiology 2022Quote: ... All shRNAs were generated by cloning shRNA hairpin sequences found in Table 3 into pLKO.1-TRC Puro (pLKO.1-TRC cloning vector was a gift from David Root (Addgene plasmid # 10878; http://n2t.net/addgene:10878; RRID:Addgene_10878) or pLKO.1-blast (pLKO.1-blast was a gift from Keith Mostov (Addgene plasmid #26655 ...
-
bioRxiv - Neuroscience 2021Quote: Mice were injected with 100nL of retrograde AAV-Syn-eGFP (Titer: 1×1013 GC/mL, Lot#V16600, Addgene) in PF (N=6) ...
-
bioRxiv - Neuroscience 2021Quote: ... The pcDNA3.1-SARS2-Spike plasmid was a gift from Fang Li (Addgene plasmid # 145032; http://n2t.net/addgene:145032; RRID:Addgene_145032) 39 ...
-
bioRxiv - Neuroscience 2021Quote: ... working dilution 1:5) was a gift from Douglas Kim (Addgene viral prep #100833-AAV9; http://n2t.net/addgene:100833; RRID:Addgene_100833). pAAV5-hSyn-dLigh1.2 (titer ≥ 4×1012 vg/ml ...
-
bioRxiv - Genomics 2022Quote: ... Per transfection reaction we used 7.5ul of 1 mg/mL polyethyleneimine (PEI) and 2.325 μg of total plasmid DNA (825 ng psPAX2: Addgene #12260 ...
-
bioRxiv - Immunology 2021Quote: ... To be consistent with the pHDM-Wuhan-Hu-1-delta21 and pHDM-D614G-delta21 plasmids obtained from Addgene, the c-terminal 21 amino acid on all the variants were deleted (Crawford et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... was generated by ligating oligonucleotides containing the targeting sequence 5’-CAGTTCCTGGGTGGAGCTA-3’ into pLKO.1-puro (Addgene # 8453). The mitochondrial (CMV-mitoCAR-GECO1 ...
-
bioRxiv - Cell Biology 2020Quote: ... SKO cells were transfected with pSH-EFIRES-P-GFP(1-10)opti AAVS1 Safe Harbor integration plasmid (Addgene plasmid # 129416 ...
-
bioRxiv - Neuroscience 2021Quote: ... Yzhar) or 250 nl of AAV1-syn-FLEX-jGCaMP7s-WPRE (titer: 1×1012 vg/ml Addgene #104487-AAV1).
-
bioRxiv - Microbiology 2021Quote: Lentiviral stocks were generated by co-transfection of 1 μg plentiCRISPRv2 (a gift from Dr. Feng Zhang (Addgene plasmid #52961; http://n2t.net/addgene:52961; RRID:Addgene_52961)) ...
-
bioRxiv - Microbiology 2021Quote: Lentiviral stocks were generated by co-transfection of 1 μg plentiCRISPRv2 (a gift from Dr. Feng Zhang (Addgene plasmid #52961 ...
-
bioRxiv - Genomics 2020Quote: ... EF06R (5’UTR-LINE-1) was a gift from Eline Luning Prak (Addgene plasmid # 42940; http://n2t.net/addgene:42940; RRID:Addgene_42940)43 ...
-
bioRxiv - Genomics 2020Quote: ... pBS-L1PA1-CH-mneo (CMV-LINE-1) was a gift from Astrid Roy-Engel (Addgene plasmid # 51288; http://n2t.net/addgene:51288; RRID:Addgene_51288)42 ...
-
bioRxiv - Neuroscience 2020Quote: ... A pLKO.1-TRC vector (a gift from David Root; Addgene plasmid #10879; http://n2t.net/addgene:10879; RRID:Addgene_10879) [32] was cloned into an expression vector with an mCherry reporter (Addgene plasmid #114199 ...
-
bioRxiv - Neuroscience 2020Quote: Recombinant adeno-associated virus carrying the GCaMP6f gene (AAV2/1:hSyn-GCaMP6f) was obtained from Addgene (100837-AAV1) with titer ≥ 1×1012 ...
-
bioRxiv - Cancer Biology 2021Quote: ... pLenti CMV Puro LUC (w168-1) was a gift from Eric Campeau & Paul Kaufman(45) (Addgene plasmid # 17477; http://n2t.net/addgene:17477; RRID:Addgene_17477) and pLL-EF1a-rFLuc-T2A-GFP-mPGK-Puro (LL410PA-1 ...
-
bioRxiv - Cell Biology 2021Quote: ... but with a pLKO.1-based vector (gift from Elaine Fuchs, Addgene plasmid # 25999; http://n2t.net/addgene:25999; RRID:Addgene_25999). GFP-H2B transduced cells were sorted by the University of Chicago Cytometry and Antibody Technology Core.
-
bioRxiv - Biochemistry 2022Quote: ... which was then used as a donor to transfer mitoLbNOX into pLenti-CMV-Hygro-DEST (w117-1) (Addgene, 17454 a gift from Eric Campeau & Paul Kaufman ...
-
bioRxiv - Cancer Biology 2022Quote: ... or control vectors pGIPZ (Dharmacon) or pLKO.1 (a gift from David Sabatini, Addgene plasmid #1864; http://n2t.net/addgene:1864; RRID:Addgene_1864) were employed for Vangl2-depletion studies ...