Labshake search
Citations for Addgene :
1051 - 1100 of 2285 citations for Rat Carboxypeptidase A3 Mast Cell CPA3 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... the 70-80% confluent cells were transfected with 780 ng psPAX2 (Addgene plasmid #12260), 510 ng pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Immunology 2021Quote: ... human embryonic kidney 293T/17 cells were transfected with pcDNA3.1(-)hACE2 (Addgene plasmid #1786). Transfection was performed in 293T/17 cells using the genejuice (Novagen ...
-
bioRxiv - Cell Biology 2021Quote: Lentivirus was generated in 293T cells using delta 8.9 and pHCMV-EcoEnv (Addgene 15802) as packaging plasmids and 25kDa linear PEI as a transfection agent ...
-
bioRxiv - Cell Biology 2019Quote: ... cells expressing GFP-tagged endogenous CLIC4 were transfected with Cry2PHR-mCH-RhoA (Addgene #42959). Cells were kept in the dark and incubated for 24 hours ...
-
bioRxiv - Cancer Biology 2021Quote: ... 293T cells were transfected with lentiviral packaging vectors (3 μg pSPAX2 (Addgene plasmid, 12260) and 1 μg pMD2.G (Addgene plasmid ...
-
bioRxiv - Molecular Biology 2022Quote: ... HeLa cells (ATCCCCL-2) were transiently transfected with SpCas9-expressing PX459 plasmid (Addgene # 62988) using Lipofectamine 2000 (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2022Quote: Parental Cas9 cell lines were generated by viral infection with lentiCas9-Blast (Addgene, # 52962) followed by blasticidin selection for 7 days ...
-
bioRxiv - Cell Biology 2022Quote: For transient cell transfections the following plasmids were used: talin-mCherry (Addgene plasmid # 55137), vinculin-mCherry14 ...
-
bioRxiv - Cell Biology 2022Quote: ... RAW264.7 cells seeded onto coverslips were transfected with GCpGP-CMV-GCaMP6s (Addgene plasmid 40753) using FuGENE HD (Promega) ...
-
bioRxiv - Developmental Biology 2022Quote: Lentiviral transfer vectors were transfected into 293T cells with packaging vector pspax2 (Addgene, 12260) and envelop vector vsvg using linear polyethylenimine ...
-
bioRxiv - Molecular Biology 2023Quote: Mitochondrial immunoprecipitations were performed using K562 cells expressing an HA-mito tag (Addgene #83356) or a control MYC-mito tag (Addgene #83355 ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were co-transfected with 750 ng of pCMV-PE2 Plasmid (Addgene Plasmid #132775) and 250 ng of assembled pU6-pegRNA-GG-acceptor using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Molecular Biology 2022Quote: HEK293T cells (∼107) were transiently transfected with either pRK5-MYC-mTOR (Addgene plasmid #1861) or pRK5-MYC-mTOR kinase-dead (Addgene plasmid #8482) ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were transfected 24h before the imaging with Str-Ii_VSVG-SBP-EGFP (Addgene #65300). Live imaging was performed with a spinning disk microscope for 45 min and one frame was acquired every 30 sec ...
-
bioRxiv - Synthetic Biology 2024Quote: Phagemid-containing supernatants were added to 2.5 mL S2060 cells (streptomycin-resistant, Addgene #105064) grown to OD600 = 0.5 and allowed to infect at 37 °C and 250 rpm for 1 h ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Cells were transiently transfected with 1 μg of each plasmid expressing GCaMP6s (Addgene #277314.1040753) (Chen et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... MutuI cells were transduced with lentiparticles derived from pCW-Cas9-Blast (Addgene Plasmid #83481) and selected for stable integration with 10 μg/mL blasticidin ...
-
bioRxiv - Neuroscience 2024Quote: ... HEK293T cells were co-transfected with the second-generation packaging plasmid psPAX2 (Addgene #12260), envelope plasmid VSV-G (Addgene #12259 ...
-
bioRxiv - Cell Biology 2024Quote: ... Both Flox and iKO cells were transfected with 600ng of tfLC3 plasmid (Addgene, 21704) using Lipofectamine LTX (Invitrogen ...
-
bioRxiv - Biophysics 2023Quote: ... HEK293T cells were co-transfected with the second-generation packaging plasmid psPAX2 (Addgene #12260), envelope plasmid VSV-G (Addgene #12259 ...
-
bioRxiv - Cell Biology 2024Quote: ... AICSDP-82:SON-mEGFP was a gift from Allen Institute for Cell Science (Addgene plasmid # 133964 ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were transduced with lentivirus generated from the PIP-FUCCI plasmid (Addgene plasmid #138715) as described above ...
-
bioRxiv - Cell Biology 2024Quote: CRISPR-based knockout cell lines were generated using the lentiCRISPRv2 vector obtained from Addgene, which expresses a single guide RNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cells were sequentially transduced with lentiviruses of the lentiCRISPR-Puro (Addgene plasmid #52961) expressing Tp53 sgRNA (CCTCGAGCTCCCTCTGAGCC ...
-
bioRxiv - Cancer Biology 2024Quote: H1299 cells were engineered with stable Cas9 expression using Lenti-Cas9-blast (Addgene #52962). Efficient nuclease activity was confirmed using a reporter system (Addgene #67979 ...
-
bioRxiv - Cancer Biology 2024Quote: HT29 cells previously infected with pLenti-U6-tdTomatato-P2A-BlasR (LRT2B) virus (Addgene, 1108545) that enables dual production of firefly luciferase and TdTomato were used ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were also stably transfected with GFP-CD63 and mCherry-CD81 plasmids (Addgene, USA) for exosomal tracking ...
-
bioRxiv - Cell Biology 2023Quote: ... The GIGYF1-KO A549 cells were generated using Lenti-Cas9-Blast (Addgene, plasmid 52962) and pLenti-CRISPRv2 (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... PEX3 KO or PEX19 KO cells were co- transfected with pMD2.G (Addgene, 12259), psPAX2 (Addgene,12260 ...
-
bioRxiv - Biochemistry 2023Quote: ... and TEV protease cleavage site into an insect cell expression vector (Addgene plasmid #55218). The same expression construct was cloned into a bacterial expression vector (Addgene plasmid #29708) ...
-
bioRxiv - Cancer Biology 2023Quote: ... KMS11 or JJN3 cells were transduced with the pCW-Cas9-Blast vector (#83481, Addgene) to establish stable Cas9+KMS11 and Cas9+JJN3 cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA from RPE1 cells was cloned into pLenti CMVie-IRES-BlastR (Addgene plasmid #119863). PAXIP1 W75R ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were transfected with 0.24μg EGFP-LC3 plasmid DNA (Addgene #11546; Watertown, MA, USA) using the FUGENE6 transfection reagent (Promega ...
-
bioRxiv - Biophysics 2023Quote: ... Cells were transfected with paxillin-pEGFP (a gift from Rick Horwitz; Addgene plasmid #15233) using a microporator (Neon Transfection System ...
-
bioRxiv - Cancer Biology 2023Quote: ... and PEI transfected into HEK293T cells along with pUMVC retroviral packaging construct (Addgene # 8449) and VSVG envelope construct (Addgene #8454) ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... carbenicillin/ampicillin resistance was introduced into NA22 competent cells using pUC1975 (Addgene, product #50005) to generate strain PXKR1 ...
-
Astroglia proliferate upon biogenesis of tunneling nanotubes and clearance of α-synuclein toxicitiesbioRxiv - Cell Biology 2023Quote: One population of U-87 MG cells were transiently transfected with pLV-mitoDsRed (Addgene #44386 ...
-
bioRxiv - Genomics 2023Quote: K562 CRISPRi cells were transduced with the hCRISPRi-v2 top 5 library (Addgene #83969)138 with 840X representation ...
-
bioRxiv - Genetics 2023Quote: ... 293T cells were transfected with the plasmids pCMVR8.74 (a gift from Didier Trono (Addgene plasmid #22036 ...
-
bioRxiv - Neuroscience 2023Quote: ... At DIV0 cells were infected with either AAV-Cre-GFP-hSyn (Addgene, 105540-AAV9) or AAV-GFP (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: The producer cell line HEK 293TN was transfected with the packaging (psPAX2, Addgene 12260), envelope (pMD2.G ...
-
bioRxiv - Cancer Biology 2023Quote: Cas9-expressing DND-41 cells were transduced with Human GeCKOv2 library (Addgene 1000000048, 1000000049) at MOI~0.3 and selected with 1μg/ml of puromycin for 6 days ...
-
bioRxiv - Cell Biology 2022Quote: ... After 24 h cells were co-transfected with 1.3 pmol of psPAX2 (Addgene, 12260), 0.72 pmol pCMV-VSV-G (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: MiaPaCa2 cells were transfected with the bicistronic pcDNA3-RLUC-POLIRES-FLUC plasmid (Addgene 45642) (55 ...
-
bioRxiv - Cancer Biology 2023Quote: ... GBM cells (G411) were transduced with lentiviral vector pBMN (CMV-copGFP-Luc2-Puro, Addgene plasmid #80389 ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 cells were transfected with pFlagCMV2-14-3-3sigma (Addgene, Cambridge, MA, Plasmid #12453) (68) ...
-
bioRxiv - Cell Biology 2023Quote: ... a stable cell line was created using pLV-Stargazin-mTurquoise2-iLID (Addgene Plasmid #161001) (54 ...
-
bioRxiv - Cancer Biology 2023Quote: VUMC-ATRT-01 cells were transduced (lentiviral) with a LentiCRISPR v2 plasmid (#52961, Addgene) that was cloned with a p53-sgRNA (Supplementary table S2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Lysosome/autophagosome fusion was estimated in ARPE19 cells overexpressing only GFP-LC3 (24920, Addgene) or both GFP-LC3 and AKT2 constructs ...
-
bioRxiv - Cell Biology 2023Quote: CRISPR mediated knock-outs were performed by transducing HEK293 cells with LentiCRISPRV2 (Addgene #52961) lentivirus expressing sgRNAs targeting genes of interest (FASTKD5_sg1 ...