Labshake search
Citations for Addgene :
1151 - 1200 of 3696 citations for pLenti CMV TO Puro DEST 670 1 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... CMV-mRuby-bGH insert was amplified from pcDNA3-mRuby2 plasmid (Addgene, Plasmid #40260) with primers containing mircohomology sequences against specific GSHs and AAVS1 site with 10bp of overlapping ends for the pcDNA3 backbone ...
-
bioRxiv - Biochemistry 2022Quote: ... The pGP-CMV-jGCaMP7s was a gift from Douglas Kim & GENIE Project (Addgene plasmid # 104463 ...
-
bioRxiv - Cell Biology 2022Quote: ... CMV-GCaMP6s was a gift from Douglas Kim and the GENIE Project (Addgene plasmid #40753 ...
-
bioRxiv - Cell Biology 2022Quote: ... Primary adipocytes were transduced with AAV8-CMV-Cre (pENN.AAV.CMVs.Pl.Cre.rBG, Addgene #105537-AAV8 Cre) and AAV8-CMV-eGFP (pAAV.CMV.PI.EGFP.WPRE.bGH ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-CMV-TVAmCherry-2A-oG was a gift from Marco Tripodi (Addgene #104330) (Ciabatti et al ...
-
bioRxiv - Cell Biology 2022Quote: ... The MAP4K4 sequence was cloned into a pLVpuro-CMV-N-EGFP (Addgene, #122848) lentiviral plasmid using the gateway system ...
-
bioRxiv - Bioengineering 2023Quote: ... AAV9 vectors containing CMV-driven Cre plasmids were obtained from Addgene (pENN.AAV.CMVs.Pl.Cre.rBG #105537). Vectors were stored in a solution containing PBS and 0.001% Pluronic F-68.
-
bioRxiv - Cell Biology 2023Quote: ... plasmids pCDNA3.1(+)-CMV-βarrestin2-TEV (Addgene plasmid #107245; http://n2t.net/addgene:107245; RRID:Addgene_107245) and Flag Snai1 6SA (Addgene plasmid #16221 ...
-
bioRxiv - Neuroscience 2024Quote: ... or AAV2/5-CMV-EGFP (250 nl, Addgene 105530, 2 × 1013 GC / ml), and which has since been published7.
-
bioRxiv - Cell Biology 2024Quote: ... DNA fragments were created by PCR using pGD-CMV-jGCaMP7c (Addgene plasmid #105320), pcDNA3-Cyto-GCaMP3 (Addgene plasmid #64853) ...
-
bioRxiv - Neuroscience 2023Quote: ... 2.3 x 1013 vg/mL) or 200 nL/side AAV5-CMV-HI-eGFP-Cre-WPRE-SV4 (Addgene; ≥ 1 x 1013 vg/mL) was injected at a rate of 100 nL/min into the insula of Pdynlox/lox and Oprk1lox/lox mice ...
-
bioRxiv - Developmental Biology 2020Quote: ... pLenti-spsg-mSL/pW212) were made by replacing the Cas9 expression cassette of lentiCRISPR v2 (Addgene, 52961) with an NLS-mNeonGreen-P2A-BlastR or NLS-mScarlet-I-BlastR cassette using Gibson Assembly ...
-
bioRxiv - Microbiology 2021Quote: ... A375-dCas or HeLa-dCas cells were generated by transducing with pLenti-dCas9-VP64-Blast (Addgene, #61425). After 7 days of blasticidin selection ...
-
bioRxiv - Microbiology 2021Quote: The transfer vectors (pLenti-EF1A-EGFP-Blast or pLenti-EF1A-hC1QBP[NM_001212.4]-Blast) were constructed by cloning eGFP or hC1QBP[NM_001212.4] into pLenti-Cas9-Blast (Addgene; # 52962) at the BamHI and XbaI sites ...
-
bioRxiv - Immunology 2021Quote: ... 80% confluent) were co-transfected with 2.4-ug of pLenti-pLex307-ACE lentiviral transfer plasmid (Addgene: 158448), 0.8-ug of pVSV-G ...
-
bioRxiv - Microbiology 2024Quote: ... pLenti-spBsmBI-sgRNA-Hygro (a gift from Rene Maehr (Addgene plasmid #62205; http://n2t.net/addgene:62205; RRID:Addgene_62205) (97 ...
-
bioRxiv - Neuroscience 2023Quote: ... pLenti-LifeAct-tdTomato was a gift from Weiping Han (Addgene plasmid # 64048; http://n2t.net/addgene:64048; RRID:Addgene_64048). HyPerRed-mito was a gift from Vsevolod Belousov (Addgene plasmid # 60247 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pLenti-ATF4-uORF-GFP reporter plasmid was generated by placing the ATF4 5’UTR from Addgene plasmid #21850 ...
-
bioRxiv - Cell Biology 2022Quote: ... B6/N x R26 Fucci2 (Tg/+) intestines (kind gift from J. Skotheim lab, Stanford) were infected with pGK Dest H2B-miRFP670 (Addgene). For Lats DKO ...
-
bioRxiv - Biochemistry 2023Quote: ... The DNMT3A2E756A gene was synthesized by IDT and cloned into pRRL-pEF-H2B-mCherry-T2A-rTetR-Dest-SV40 (Addgene #186968).
-
bioRxiv - Cell Biology 2020Quote: FACS EPCAM+ stromal depleted organoids at d14 were infected with lentivirus at an estimated MOI of 0.9 according to Van Lidth de Jeude et al.72 with third generation lentiviral vectors (PGK-GFP T2A Puro, SBI cat# CD550A-1; mCherry modified from pLentiCRISPRv1 (Addgene #49545) to incorporate an EF-1a-mCherry P2A Puro cassette ...
-
bioRxiv - Biochemistry 2021Quote: ... shRNA targeting mSARM1 (5’-CCGGCTGGTTTCTTACTCTACGAATCTCGAGATTCGTAGAGTAAGAAACCAGTTTTTG-3’) or the scrambled shRNA (5’-CCGGCCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGTTTTTG-3’) were inserted to pLKO.1-puro (Addgene, #8453) with EcoRI and AgeI ...
-
bioRxiv - Cancer Biology 2022Quote: ... The double strand DNA coding HMGN5 shRNA and STAT3 shRNA were synthesized by Sangon Biotech (Shanghai, China) and cloned into the lentiviral vector pLKO.1-Puro (Addgene, 8453).
-
bioRxiv - Biochemistry 2021Quote: ... two double-stranded oligonucleotides targeting exon 2 of human SGTA (guide #1: 5′-CATGACCAGCTCCGGCACGG-3′ and guide #2: 5′- CAGGAACTGGATGATGGCGT-3′) were ligated into the pSpCas9(BB)-2A-puro vector (Addgene #62988) using BbsI sites ...
-
bioRxiv - Molecular Biology 2020Quote: ... The annealed oligos were diluted (1:200) and cloned into pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-Puro (encoding dCas9-KRAB; Addgene # 71236) using a Golden Gate Assembly strategy (containing ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tetracycline-inducible TET-shRB1 and constitutive shRB1 constructs were created by integrating validated siRNA sequences GAAAGGACATGTGAACTTA (63) and GAACGATTATCCATTCAAA (64) targeting human RB1 (shRB1) into TET-pLKO.1-Puro vector (Addgene #21915) and pLKO.1-Puro vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... plasmids were created by integrating validated siRNA sequences CCTGTCAGGAAACTGTATGAT (62) and AATGGCCATCAGAACGGACTT targeting human ESRRG (shESRRG) into pLKO.1-Puro vector (Addgene #8453). Non-specific siRNA sequence AACAGCCACAACGTCTATATC or siRNA sequence CAACAGCCACAACGTCTATAT targeting GFP were used as controls for shRNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... the shRNA sequences (5′-CTCATTTAGCAGACATCGCAA-3′ (shRNA-1) and 5′-CTTTACTAGGAGACGCCAATA-3′ (shRNA-2) (Zhang et al, 2012b)) were inserted into EZ-Tet-pLKO-Puro vector (Addgene, 85966), respectively ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP1-10 plasmid (pHAGE2-EF1a-GFP1-10-IRES-Puro) was generated by cloning GFP1-10 from pcDNA3.1-GFP(1-10) (Addgene Plasmid #70219) into a lentiviral vector that contains EF-1α promoter and Puromycin selection marker ...
-
bioRxiv - Molecular Biology 2023Quote: Two oligos H3F3AN-1-73F CACCGTCAATGCTGGTAGGTAAGTA and H3F3AN-1-73R AAACTACTTACCTACCAGCATTGAC containing gRNA sequence were annealed and inserted into pSpCas9-2A-Puro vector (PX459, Addgene # 62988), digested with BbsI-HF enzyme (NEB ...
-
bioRxiv - Biophysics 2021Quote: ... Twist mutants: pBABE-puro-mTwist was a gift from Bob Weinberg (Addgene plasmid # 1783 ...
-
bioRxiv - Cancer Biology 2021Quote: CRISPR guides targeting RNASEH2B were cloned into lentiGuide-Puro vector (#52963, Addgene), while CRISPR guides targeting RB1 were cloned into lenti-sgRNA hygro vector (#104991 ...
-
bioRxiv - Cancer Biology 2021Quote: ... TS600 and TS543 cell lines by viral transduction using pLVX-puro (Addgene), pLVX-puro-TRIM67-Flag plasmids ...
-
bioRxiv - Cell Biology 2020Quote: MSCV CreERT2 puro was a gift from Tyler Jacks (Addgene plasmid # 22776) (Kumar et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... and sgRNA (lentiGuide-Puro a gift from Feng Zhang (Addgene plasmid # 52963) were produced in 293FT packaging cell line by transient cotransfection ...
-
bioRxiv - Molecular Biology 2021Quote: ... OsTIR1 coding sequences were obtained from pBabe Puro osTIR1-9Myc (Addgene #80074) and subcloned into PiggyBac-dCas9-Tet1 (Liu et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... were annealed and cloned into AgeI/EcoRI-linearized tet-pLKO-puro (Addgene plasmid #21915 ...
-
bioRxiv - Genomics 2020Quote: ... Lenti-gRNA-Puro was a gift from Hyongbum Kim (Addgene no. 84752). After digestion ...
-
bioRxiv - Cell Biology 2020Quote: ... and Zubi promoters were obtained from pSpCas9(BB)-2A-Puro (Addgene # 48139), pCS2-nCas9n (Addgene # 47929) ...
-
bioRxiv - Biochemistry 2021Quote: ... pLPC-puro-N-Flag was a gift from Titia de Lange (Addgene plasmid # 12521 ...
-
bioRxiv - Cancer Biology 2020Quote: ... pCRIS-PITChv2-Puro-dTAG (BRD4) (gift from James Bradner, AddGene plasmid #91793) (Nabet et al. ...
-
bioRxiv - Genetics 2020Quote: Mouse Arid1a gRNA (GCTGCTGCTGATACGAAGGTTGG) was cloned into LentiGuide-puro plasmid (Addgene #53963). LentiCas9-Blast plasmid was purchased from Addgene (Addgene #53962) ...
-
bioRxiv - Genetics 2021Quote: ... pLVX-EF1alpha-SARS-CoV-2-orf8-2xStrep-IRES-Puro (Addgene plasmid #141390). Orf8 deletion constructs were produced on the Orf8 backbone using Pfu Turbo HotStart DNA polymerase (Agilent 600322-51 ...
-
bioRxiv - Neuroscience 2021Quote: ... and then cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988). Single-cell suspension of hiPSCs was nucleofected with 5 μg of the generated SpCas9-sgRNA plasmid using the P3 Primary Cell 4D-Nucleofector Kit (Lonza ...
-
Direct intracellular visualization of Ebola virus-receptor interaction by in situ proximity ligationbioRxiv - Microbiology 2020Quote: ... A lentiGuide-Puro plasmid (Addgene plasmid #52963, a gift from Feng Zhang) expressing human CatL-targeting sgRNA (5’-CTTAGGGATGTCCACAAAGC-3’ ...
-
bioRxiv - Microbiology 2022Quote: ... Guide RNA sequence (“sgRNA3”, AGGCATGCAAAGCTGTCATG) was subcloned into pLentiGuide-Puro (Addgene, 59702). Guide RNA expressing plasmids were packaged into lentivirus using HEK293T cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... lenti-sgRNA puro was a gift from Brett Stringer (Addgene plasmid# 104990) (Stringer et al. ...
-
KIF24 controls the clustering of supernumerary centrosomes in pancreatic ductal adenocarcinoma cellsbioRxiv - Cell Biology 2022Quote: ... annealed oligo was inserted into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene) (Ran et al ...
-
bioRxiv - Cell Biology 2020Quote: ... pSpCas9(BB)-2A-Puro (PX459) was a gift from Feng Zhang (Addgene plasmid # 48139 ...
-
bioRxiv - Molecular Biology 2022Quote: ... CaMKIIδ was cloned into pLVX:TetONE-Puro-hAXL (gift from Kenneth Pienta, Addgene plasmid # 124797 ...