Labshake search
Citations for Addgene :
1101 - 1150 of 3696 citations for pLenti CMV TO Puro DEST 670 1 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2024Quote: ... with BglII–SalI ends and inserting into pBABE puro (Addgene, 1764) digested with BamHI–SalI ...
-
bioRxiv - Systems Biology 2024Quote: ... sgRNAs were cloned into the CROPseq-puro-v2 backbone (Addgene #127458). pXPR_BRD023 (lentiCRISPR v2 ...
-
bioRxiv - Microbiology 2024Quote: Libraries were cloned into a CROP-seq-puro-v2 (Addgene #127458) backbone and lentivirus was then produced and transduced as previously described (Feldman et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... lentiGuide-puro was a gift from Feng Zhang (Addgene plasmid #52963). pFUGW-EFSp-Cas9-P2A-Zeo (pAWp30 ...
-
bioRxiv - Neuroscience 2023Quote: ... iPSCs were transduced with three lentiviruses – pTet-O-NGN2-puro (Addgene plasmid #52047 ...
-
bioRxiv - Developmental Biology 2023Quote: ... These sgRNAs were inserted individually into lentiGuide-Puro plasmid (Addgene # 52963) following the cloning protocols provided from the plasmid depositor ...
-
bioRxiv - Cancer Biology 2023Quote: ... MSCV MYC T58A puro (Addgene #18773, a gift from Scott Lowe)66 for expressing the mutant MYC ...
-
bioRxiv - Cancer Biology 2023Quote: ... was generated by cloning hRASV12 from pBABE-HRASV12-puro (Addgene #9051) into pBABE-hyg (Addgene #1765 ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLV-EF1a-IRES-Puro was a gift from Tobias Meyer (Addgene plasmid # 85132 ...
-
bioRxiv - Genetics 2023Quote: ... The backbone plasmid was modified from plasmid LentiGuide-Puro (Addgene, 52963), with an addition of a CMV promoter ...
-
bioRxiv - Cell Biology 2023Quote: ... We generated pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene Plasmid #62988) with target sequence AAACTTCATCAATAACCCGC using established protocols To generate donor plasmids ...
-
bioRxiv - Molecular Biology 2023Quote: ... and DYNLL1 were cloned in the pLentiGuide-puro vector (Addgene 52963). 24 hours after viral transduction ...
-
bioRxiv - Bioengineering 2023Quote: ... cFDB and cFPC were cloned into an AIO-Puro vector (Addgene). The DNA templates of cFDB and cFPC were respectively digested with BsaI and Bbs1 restriction enzymes (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: pBABE-puro-gateway-ERBB2 was a gift from Matthew Meyerson (Addgene plasmid No ...
-
bioRxiv - Cancer Biology 2023Quote: ... shCtrl and shHOXB13 were cloned into Tet-pLKO-puro (Addgene #21915). sgRNA and shRNA sequences can be found in Supplementary Table 1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... lentiCRISPRv2 puro was a gift from Brett Stringer (Addgene plasmid # 98290). Single-guide RNAs were designed through MIT CRISPR Designer (crispr.mit.edu) ...
-
bioRxiv - Cell Biology 2023Quote: ... linearized vector pSpCas9(BB)-2A-Puro (pX459) V2.045 (plasmid #62988; Addgene. Using the same strategy ...
-
bioRxiv - Genomics 2023Quote: LentiGuide-Puro was a gift from Feng Zhang (Addgene plasmid # 52963). The vector was modified to replace the sequence of the gRNA scaffold with the optimized sequence from Hill et al ...
-
bioRxiv - Cell Biology 2023Quote: ... pMXs-puro GFP-DFCP1 was a gift from Noboru Mizushima (Addgene plasmid #38269 ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA sequences were cloned into pSIH1-H1-puro vector (#26597; Addgene). cDNA sequences of PAK1 mutants with a C-terminus Flag tag were synthesized at BGI Genomics (Beijing ...
-
bioRxiv - Microbiology 2023Quote: ... The bovine libraries were cloned into lentiGuide-Puro plasmid (Addgene, #52963) and viruses were produced in HEK293FT cells ...
-
bioRxiv - Molecular Biology 2024Quote: ... targeting sequences were cloned into a lentiGuide-Puro plasmid (Addgene #52963)35 as previously described34 ...
-
bioRxiv - Immunology 2024Quote: ... annealed and individually cloned into vector plasmids lentiGuide-Puro (Addgene #52963) or lentiGuide-mCherry (Plasmid #170510) ...
-
bioRxiv - Microbiology 2024Quote: ... the LC3B in pBABE-puro mCherry-EGFP-LC3B (Addgene, Plasmid #22418) was replaced with the LC3C at EcoRI and SalI site to make pBABE-puro mCherry-EGFP-LC3C ...
-
bioRxiv - Molecular Biology 2024Quote: ... lysines in position 210 in pIRES-EGFP-puro (Addgene Plasmid 45567) and in position 105 in pRosetta (Addgene Plasmid 59700 ...
-
bioRxiv - Cancer Biology 2024Quote: ... the annealed oligos were ligated into pLentiCRISPR Puro V2 (Addgene #52961). Ligations were done with T4 DNA ligase for 2 hours at 25°C ...
-
bioRxiv - Synthetic Biology 2024Quote: ... mouse SOX9 was amplified from plasmid tetO.Sox9.Puro [bought from Addgene, catalog number #117269] ...
-
bioRxiv - Genetics 2024Quote: ... they were transfected with plasmid pSpCas9(BB)- 2A-Puro (Addgene, #48139) containing an sgRNA targeting the sequence just downstream of the stop codon (exon 4 ...
-
bioRxiv - Developmental Biology 2024Quote: ... were ordered from Sigma MISSION® shRNA and cloned into Tet-pLKO-puro (Addgene 21915) and Tet-pLKO-neo (Addgene 21916) ...
-
bioRxiv - Bioengineering 2024Quote: ... and CD63 were cloned into the LentiGuide-Puro construct (Addgene #52963). Lentivirus was generated using the LV-MAX Lentiviral Production Kit (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... sgRNA guides were ligated into pspCas9 (BB)-2A-Puro (Addgene, 48139) or Lenti-multi-CRISPR (Addgene 85402 ...
-
bioRxiv - Cell Biology 2020Quote: Pairs of CRISPR guide RNA oligos (mouse Chmp5 single guide RNAs [sgRNAs] targeting GGCTCCGCCACCTAGCTTGA and GTTTCGCTTTTCCGAAGAAT on exon 1 respectively) were annealed and cloned into the BsmBI sites of lentiCRISPR V2-puro vector (plasmid 52961, Addgene). CRISPR lentiviral plasmids and lentiviral packaging plasmids (pMDLg/pRRE ...
-
bioRxiv - Cancer Biology 2020Quote: ... to co-transfect pBABE-puro or pBABE-puro.SLX4IP.3xFLAG with pCMV-VSV-G (at a ratio of 6:1, Addgene#8454) into GP2-293 cells (Clontech) ...
-
bioRxiv - Cell Biology 2021Quote: ... NANOG and PRDM14 (see Table 1) were cloned into pLentiCRISPR V2 vectors with puro (SOX2, NANOG) or hygromycin B (PRDM14) resistance (Addgene plasmids #52961 and #98291 respectively ...
-
bioRxiv - Cell Biology 2021Quote: ... and pLKO.1 puro-based plasmid harboring the designed shRNA (pCMV-VSV-G and pLKO.1 puro were a gift from Bob Weinberg, Addgene plasmid #8454 ...
-
bioRxiv - Cell Biology 2020Quote: Huwe1 stable knockdown: The same targeting sequences as for siRNA studies were cloned to pLKO.1 puro plasmid (Addgene 8453). As control ...
-
bioRxiv - Cell Biology 2021Quote: ... a single guide RNA targeting Pml exon 1 (Table 4) was subcloned into the pSpCas9 (BB)-2A-Puro plasmid (pX459v2, Addgene) and transfection of mESCs was performed using lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: The sgRNA oligomers for SLC25A46 targeting exon 1 and 3 were annealed and inserted into plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 from Addgene (62988) via combined ligation (T7 ligase NEB).
-
bioRxiv - Immunology 2024Quote: ... One microliter of 1:100 diluted product was used for golden gate cloning into lentiCRISPR v2-Puro (Addgene plasmid #52961) using 11 cycles of 5 minutes T4 ligase ligation at 16 °C and 5 minutes of BsmbI digestion at 37 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... Short hairpin RNAs (shRNAs) targeting WSB2 or BCL-2 family proteins were subcloned into the pLKO.1 puro vector (Addgene) for gene KD ...
-
bioRxiv - Immunology 2024Quote: ... the oligo targeti ng NAIP (5’-CCGGGCCGTGGTGAACTTTGTGAATCTCGAGATTCACAAAGTTCACC ACGGCTTTTTG-3’ and 5’-AATTCAAAAAGCCGTGGTGAACTTTGTGAATCTCGAGA TTCACAAAGTTCACCACGGC-3’) was cloned into pLKO.1 puro (8453, Addgene), w hich was then used for lentiviral construct as above ...
-
bioRxiv - Developmental Biology 2024Quote: ... gRNAs 1 and 2 (Supplemental Table 2) were cloned into the pSpCas9n(BB)-2A-Puro (PX462) V2.0 plasmid (Addgene 62987) as described previously70 ...
-
bioRxiv - Cell Biology 2024Quote: ... 100,000 HeLa M cells were plated per well in a 6-well plate and transfected the following day at a ratio of 1:15 with the pEGFP-Puro plasmid (45561; Addgene) and gRNA-containing plasmid (pX330A-1×2) ...
-
bioRxiv - Developmental Biology 2022Quote: ... An AAV virus that constitutively expresses eGFP from CMV promoter (Addgene, 105545-AAV9) was used as a cell labeling control (Supplementary Fig ...
-
bioRxiv - Systems Biology 2021Quote: ... we co-transfected the library and CRE recombinase (pBS185 CMV-Cre, Addgene 11916) into 4 K562 ‘landing pad’ cell lines expressing the thymidine kinase (TK ...
-
bioRxiv - Neuroscience 2021Quote: ... pGP-CMV-NES-jRGECO1a was a gift from Douglas Kim & GENIE Project (Addgene plasmid # 61563 ...
-
bioRxiv - Neuroscience 2022Quote: ... phCMV-10A1 (#15805) and pBS-CMV-gagpol (#35614) plasmids were obtained from Addgene.
-
bioRxiv - Bioengineering 2021Quote: ... Addgene plasmid # 92046)33 and 1μg CMV-SB10 (a gift from Perry Hackett, Addgene plasmid # 24551).
-
bioRxiv - Cell Biology 2020Quote: ... were gifts from Pawel Pelczar.32 pLV-CMV-LoxP-DsRed-LoxP-eGFP (Addgene plasmid #65726 ...
-
bioRxiv - Cell Biology 2021Quote: ... pGP-CMV-GCaMP6f and pCMV CEPIA2mt were obtained from Addgene (Watertown, MA, USA). Cells were transfected with each plasmid for 5 h using Lipofectamine 2000 (Life Technologies ...