Labshake search
Citations for Addgene :
1101 - 1150 of 2537 citations for 2 1H Imidazol 1 yl 6 methyl 4 pyrimidinemethanamine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... iPSCs were transfected with pRT43 containing DHFR-dCas9-VPH and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT- C13-L1, gifts from Jizhong Zou (Addgene plasmid # 62196 ...
-
bioRxiv - Genomics 2021Quote: An sgRNA targeting PSAP exon 2 (sgRNA sequence: GGACTGAAAGAATGCACCA) was cloned into plasmid px330-mcherry (px330-mcherry was a gift from Jinsong Li (Addgene plasmid # 98750 ...
-
bioRxiv - Neuroscience 2021Quote: Cultured Cdh11 wild-type and knockout hippocampal neurons (300,000 cells/2 cm2) were transfected at 3 DIV or 9 DIV with the pLL3.7-GFP vector (Addgene Cat#11795) using Lipofectamine 2000 (Invitrogen Cat#11668-019 ...
-
bioRxiv - Genomics 2022Quote: The PCR product was cloned into the pBS-KS-attB1-2-PT-SA-SD-0-2xTY1-V5 vector (Addgene #6125554) using HindIII and XbaI restriction sites ...
-
bioRxiv - Neuroscience 2022Quote: ... that target exon 2 of TREM2 nearby the location of R47H (G>A) and a genomic TTAA were purchased from Addgene. A donor plasmid was made comprising homology arm 1 (HA1 ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids encoding spikes of SARS-CoV-2 variants Delta (Cat. No. 172320) and Omicron (Cat. No. 179907) were procured from Addgene, USA.
-
bioRxiv - Cell Biology 2024Quote: ... These two plasmids were co-electroporated with a plasmid encoding the sgRNA for the gene locus (Supplementary Table 2, Addgene #47108 ...
-
bioRxiv - Biochemistry 2024Quote: ... expressing Cas9 nuclease and two gRNAs (see below for sequences) together with the CRIS-PITCh vector pX330S-2-PITCh (63670, Addgene), harboring the Lamin A microhomologies and GFP-Puro or GFP-Neo/Kan insertions ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR products or Plasmids were micro-injected into CB4088 [him-5(e1490)] hermaphrodites with myo-2::mCherry from plasmid pCFJ90 (Addgene) as co-injection marker ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNAs targeting mouse and human genes of interest (see Supplementary Table 2) were cloned into plenti-sgRNA (Addgene plasmid #71409) using BsmbI and into Cas9 plasmid (Addgene plasmid #62988)(Ran et al ...
-
bioRxiv - Systems Biology 2023Quote: ... Lentiviruses were packaged according to the following protocol: Shuttle plasmid (8 μg), psPAX2 packaging vector (2 μg, a gift from Didier Trono (Addgene plasmid #12260 ...
-
bioRxiv - Microbiology 2023Quote: ... SARS-CoV-2 virus-like particles were prepared as previously described (68) by co-transfecting plasmids for N (Addgene 177937); M and E (Addgene 177938) ...
-
bioRxiv - Bioengineering 2023Quote: ... OCI-AML-2 and OCI-AML-3) were retrovirally transduced with MI-Luciferase-IRES-mCherry (gift from Xiaoping Sun, Addgene plasmid #75020 ...
-
bioRxiv - Physiology 2023Quote: ... sgRNA primers were (Table 2) cloned into BbsI-HF linearized pU6-(BbsI)_CBh-Cas9-T2A-mCherry (Addgene, Plasmid Cat. #64324) or pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene ...
-
bioRxiv - Biophysics 2023Quote: ... cells transfected with pcDNA3.1-mGL-picALuc plasmid along with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2xStrep-IRES-Puro (Mpro WT) (a gift from Nevan Krogan (Addgene plasmid # 141370 ...
-
bioRxiv - Biophysics 2023Quote: ... RRID:Addgene_141370)72 or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (C145A mutant Mpro) plasmid (a gift from Nevan Krogan (Addgene plasmid # 141371 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... cells were co-transfected using Lipofectamine 3000 and 15μg of DNA encoding for viral protein (pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian - Addgene plasmid # 145780 ...
-
bioRxiv - Genetics 2023Quote: ... Forward and reverse oligos (CACCGCTGCTGCTGCTGCTGCTGGA and AAACTCCAGCAGCAGCAGCAGC) (IDT) for gRNA 2 were cloned into the BSmBI site of pCbh_v5 AAV-CBE C-terminal (Addgene, # 137176) and pCbh_v5 AAV-CBE N-terminal (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: A 2.2 kb BamHI-SalI cDNA fragment of the long form of human PREPL (PREPLL) was cloned into pLenti-GFP (Addgene) digested with the same restriction enzymes ...
-
bioRxiv - Cell Biology 2023Quote: ... the resistance cassette flanked by LoxP sites (Sec16) was excised by transfection of 2 µg of pBS598 EF1alpha-EGFPcre plasmid (plasmid #11923; Addgene) that encodes for cre recombinase.
-
bioRxiv - Microbiology 2023Quote: ... encoding the Spike glycoprotein of Wuhan SARS-CoV-2 fused to a C-terminal C9 tag (SW) was a kind gift from Fang Li (Addgene plasmid # 145032 ...
-
bioRxiv - Cell Biology 2023Quote: ... The sgRNA expression vectors were generated by cloning appropriate DNA oligonucleotides (Supplementary Table 2) into the BbsI restriction sites of the pX459 vector (#62988, Addgene). An empty pX459 vector was used to generate matching control cell lines ...
-
bioRxiv - Biophysics 2023Quote: ... and 15 µg of the plasmid encoding the respective viral surface protein (pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian - Addgene plasmid # 145780 ...
-
bioRxiv - Neuroscience 2024Quote: ... Titer: 2 × 1012 virus molecules/ml) and placed a second microinjection of 200 nl of AAV8-hSyn-DIO-mCherry (Addgene, Catalog#50459-AAV8 ...
-
bioRxiv - Neuroscience 2024Quote: ... or 2 μg of a dominant-negative PAK1 plasmid (pCMV6M-PAK1 H83L H86L K299R, Addgene plasmid # 26592 by Jonathan Chernoff). This transfection was maintained for two days ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV1-hSyn-GCaMP6f-P2A-nls-dTomato virus (titer 2 × 1013 GC/mL) that co-expresses GCaMP and nucleus-localized static tdTomato signals was purchased from Addgene, which was a gift from Jonathan Ting (Addgene viral prep #51085-AAV1 ...
-
bioRxiv - Molecular Biology 2024Quote: We transfected HAP1 cells with 2 µg of pX330 U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid #42230; (Cong et al, 2013)) containing LAD-specific or AVVS1-specific guide RNAs ...
-
bioRxiv - Cancer Biology 2024Quote: ... with the plasmid of interest (POI) and two plasmids encoding packaging proteins for viral vector (pAX.2 Addgene Plasmid #35002), pMD2.G Addgene Plasmid #12259) ...
-
bioRxiv - Cancer Biology 2024Quote: ... targeting two regions of ATP5I’s cDNA (sgATP51 #1 and sgATP5I #2) and one RNA guide targeting GFP (sgGFP) sequence were subcloned into BsmBI restriction site of lentiCRISPRv2 plasmid (#52961, Addgene). For re-expression of ATP5I in control (sgGFP ...
-
bioRxiv - Neuroscience 2024Quote: ... (2) PV-Cre mice were injected with Cre-dependent retrograde AAVrg-hSyn-DIO-EGFP (1.4E13 GC/ml, Addgene, #50457-AAVrg) or AAVrg-FLEX-tdTomato (1.2E13 GC/ml ...
-
bioRxiv - Microbiology 2024Quote: ... A549 cells were transfected with 2 µg DNA of ARF1-GFP48 (ARF1-GFP was a gift from Paul Melancon, Addgene plasmid #39554 ...
-
bioRxiv - Biochemistry 2024Quote: ... cells were transiently co-transfected for 24 h with plasmids for expression of full-length, N-terminal tagged (Flag, HA or tandem Strep tag) BRSK1/2 (or Cys-Ala mutants) and EGFP-TAU (Addgene), using 3:1 polyethylenimine (average Mw ...
-
bioRxiv - Plant Biology 2024Quote: ... two suitable sgRNA targeting ICL - exon 2 were designed using CRISPOR (Concordet and Haeussler, 2018) and cloned in pDGE Shuttle vectors (Addgene plasmid #153241 pDGE332 and Addgene plasmid #153243 pDGE334 ...
-
bioRxiv - Plant Biology 2024Quote: ... the BlpR cassette was replaced by a hygromycin resistance gene under control of the switchgrass polyubiquitin 2 promoter and the 35S terminator derived from plasmid JD633 (Addgene no ...
-
bioRxiv - Immunology 2024Quote: ... lentiviral particles were produced by co-transfection of 2 × 106 293T cells with 5 μg of LentiCRISPRv2GFP plasmid (Addgene # 82416) expressing the gRNA targeting the gene of interest or non-targeting control (CTRL ...
-
bioRxiv - Biophysics 2024Quote: ... The cloning of 2×Cox8-mGold-HaloTag was synthesized by Tsingke Biotech (Beijing, China) by referencing mEmerald-Mito-7 (plasmid 54160, Addgene) using seamless cloning.
-
bioRxiv - Neuroscience 2022Quote: ... then virus (AAV9-CaMKII-Cre, stock 2.1*1013 particles/nL, 1:1 dilution in PBS, Addgene) was pressure injected (NanoJect III ...
-
bioRxiv - Neuroscience 2021Quote: The lentiviral knockdown constructs were made using pLKO.1-Puro or pLKO.1-GFP plasmids (Addgene) (Zhuang et al ...
-
bioRxiv - Neuroscience 2024Quote: ... 3.26e14 GC-ml) diluted 1:1 with PBS or AAV5-CaMKII-GCaMP6f.WPRE.SV40 (Addgene, 2.3e13 GC-ml) diluted with PBS 1:2 into dorsal CA1 (−1.8 mm from Bregma ...
-
bioRxiv - Molecular Biology 2020Quote: ... and residues 1-133 (Addgene #138422) were PCR amplified from pcDNA4/TO-ORF24-3xFLAG (19 ...
-
bioRxiv - Developmental Biology 2021Quote: pLKO.1-puro plasmids (Addgene #8453) were cloned as previously described (78) ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLKO.1 Scrambled shRNA (#1864, Addgene), pLKO.1 HIF2α shRNA (#TRCN0000082307 ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLKO.1-TRC (shSCR) (Addgene; 10879) was used as a control ...
-
bioRxiv - Microbiology 2020Quote: ... and AdEasier-1 cells (Addgene #16399) were a gift from Bert Vogelstein (He et al ...
-
bioRxiv - Biochemistry 2022Quote: ... cloned into pMSCVpuro (Addgene #K1062-1) at Hpa1 and EcoR1 sites to create pMSCVpuro-His-mCherry ...
-
bioRxiv - Developmental Biology 2021Quote: ... U6-1 and U6-3 (Addgene plasmid #83954 ...
-
bioRxiv - Developmental Biology 2020Quote: ... pLKO.1-shSCR (Addgene, Plasmid #1864), was obtained from Addgene (Cambridge ...
-
bioRxiv - Microbiology 2022Quote: ... 1 -hygro vector (Addgene, plasmid #24150) was used to generate the pLKO.1-hygro-AMOTL1-sh construct ...
-
bioRxiv - Microbiology 2022Quote: ... psPAX2 (HIV-1 gag/pol) (Addgene) and pMD2.G (encoding VSV-G ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 1 µg psPAX2 (Addgene 12260) using PEI and following standard protocol.Viral supernatant was harvested after 60 h ...