Labshake search
Citations for Addgene :
901 - 950 of 2537 citations for 2 1H Imidazol 1 yl 6 methyl 4 pyrimidinemethanamine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... the human CRISPR 2-plasmid activation pooled library (SAM) was a gift from Feng Zhang (Addgene #1000000078) and used for CRISPR activation screening ...
-
bioRxiv - Synthetic Biology 2020Quote: ... targeting the LMNB1 gene (GGGGTCGCAGTCGCCATGGC) (2 ug) and an LMNB1-mEGFP containing repair vector (Addgene plasmid #87422) (3 μg ...
-
bioRxiv - Microbiology 2021Quote: ... The SARS-CoV-2 S-mEmerald construct was made by cloning the mEmerald sequence (Addgene, Plasmid #53976) to the C-terminal end of the SARS CoV-2 S-protein in the pCG expression vector ...
-
bioRxiv - Neuroscience 2020Quote: kn-p65AD was generated by co-injecting pBS-KS-attB2-SA(2)-T2A-p65AD-Hsp70 (Addgene #62915) and ΦC31 into the embryos of MI15480 (BL61064) ...
-
bioRxiv - Cancer Biology 2021Quote: Guide RNAs for TP53 and SETD2 were constructed and cloned into lenti CRISPR v-2 (Addgene, 52961) according to the original online protocol of the Zhang lab (http://www.genome-engineering.org/crispr/wp-content/uploads/2014/05/CRISPR-Reagent-Description-Rev20140509.pdf) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and 0.5 μg of SARS-CoV-2 Spike plasmid (a gift from Fang Li, Addgene plasmid #145032) using Lipofectamine 3000 transfection reagent (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... Retroviruses were generated by co-transfection of viral vectors (2 μg) with pCMV-VSVG (0.25 μg) (Addgene) into Phoenix-gp cells with 90% confluency in a 6-well plate ...
-
bioRxiv - Microbiology 2022Quote: ... and are also available on Addgene (pLVX-EF1alpha-SARS-CoV-2-nsp14-2xStrep-IRES-Puro, Addgene #141380). Nsp10-Flag plasmid was a gift from the Ott lab.
-
bioRxiv - Biophysics 2022Quote: ... These cells (1.5 × 106) were transfected with 2 μg of plasmid encoding eGFP-Cre recombinase (Addgene # 11923), a gift from Brian Sauer (Le et al. ...
-
bioRxiv - Immunology 2022Quote: ... the SARS-CoV-2 S HexaPro plasmid was a generous gift from Jason McLellan (Addgene plasmid # 154754) (19) ...
-
bioRxiv - Neuroscience 2020Quote: ... for imaging hippocampal pyramidal cells or pAAV-mDlx-GCaMP6f-Fishell-2 (a gift from Gordon Fishell, Addgene plasmid # 83899 ...
-
bioRxiv - Neuroscience 2021Quote: ... mice received 50 nL of helper AAV2/8 syn.dio.TVA.2A.GFP.2A.B19G (UNC vector core) followed 2 weeks later by 300nl of rabies SAD.B19.EnvA.ΔG.mCherry (SAD-B19 strain, Addgene Cat# 32636 prepared by the Salk institute vector core ...
-
bioRxiv - Neuroscience 2022Quote: ... and SNORD115 were designed using MIT’s CRISPR Design Tool (http://crispr.mit.edu; Supplemental Table 2) and cloned into pX459v2.0 (Addgene 62988) vector ...
-
bioRxiv - Cancer Biology 2020Quote: ... or with 2 μg/ml puromycin (Gibco) (pTK93_Lifeact-mCherry; a gift from Iain Cheeseman, Addgene plasmid #46357) for 3 days ...
-
bioRxiv - Immunology 2021Quote: Plasmid pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian (Addgene plasmid # 145780)68 ...
-
bioRxiv - Cancer Biology 2021Quote: ... #2: 5’-caccgTGAAACGGATTCTTCTTTCG-3’) and cloned into the Cas9 plasmids pSpCas9(BB)−2A-Puro (PX459, Addgene #62988) and pSpCas9(BB)-2A-GFP (PX458 ...
-
bioRxiv - Microbiology 2023Quote: ... along with a luciferase gene with SARS-CoV-2 packaging sequence PS9 into 293T cells (Addgene 177942). Plasmids were gifts from Jennifer Doudna ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids encoding HCoV-229E and SARS-CoV-2 N proteins were obtained from Addgene (#151912 and #141391). C-terminally FLAG-tagged 229E N and SARS-CoV-2 N constructs were cloned into pcDNA3.1 using specific primer sequences (Supplementary Table S1).
-
bioRxiv - Immunology 2023Quote: ... the SARS-CoV-2 S 6P expression vector was a gift from Jason McLellan (Addgene plasmid #154754). The secreted protein was captured by Strep-Tactin affinity chromatography ...
-
bioRxiv - Genetics 2023Quote: ... The germline licensed Cas9 and tbb-2 3’ UTR were amplified from pCFJ150-Cas9 (dpiRNA) (Addgene ID107940) (Zhang et al. ...
-
bioRxiv - Physiology 2022Quote: ... The pTwist-EF1a carrying the SARS-CoV-2 E protein with 2xSTREP tags were obtained from Addgene. pCMV-rpHluorin-N1 was a kind gift from Dr ...
-
bioRxiv - Molecular Biology 2024Quote: The plasmid pLVX-EF1alpha-SARS-CoV-2-orf6-2xStrep-IRES-Puro (Addgene plasmid #141387 from Nevan Krogan) [12] was used for the overexpression of the accessory proteins ORF6 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and pCOLA-Gent-EM7-Erv1p-PDI were both cloned with 2 fragment gibson assemblies (Addgene Cat#202486). For each assembly ...
-
bioRxiv - Developmental Biology 2023Quote: ... tbb-2 sequence was amplified using primers RA1792 and RA1793 and cloned into pPD95.75 (Addgene plasmid #1494) digested with EcoRI and SpeI using the NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... UL123 was also cloned into pLVX-EF1alpha-SARS-CoV-2-nsp1-2XStrep-IRES-Puro (Addgene plasmid #141367) in place of the SARS-CoV-2-nsp1-2XStrep cassette ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli codon optimized SARS-CoV-2 genes from plasmid vectors synthesized by GinkoBioworks and distributed by Addgene. Amplified genes were digested with NdeI and SacI ...
-
bioRxiv - Biophysics 2023Quote: ... pCAGGS-SARS-CoV-2 S D614G (# 156421) and pcDNA3.1 vectors were obtained from Addgene (Watertown, MA, USA), and Invitrogen (Waltham ...
-
bioRxiv - Biochemistry 2023Quote: ... The pDONR223-PRKCB2 (PKCβII, uniprot identifier: P05771-2) was a gift from William Hahn & David Root (Addgene plasmid #23746 ...
-
bioRxiv - Biochemistry 2023Quote: The coding sequence for α-actinin-2-ABD was obtained from Addgene (RefSeq: NM_001103.3, Plasmid ID 52669) and PCR amplified using the forward primer AAACACCTGCAAAAAGGTATGAACCAGATAGAGCCCGGC and reverse primer AAATCTAGATTACTCCGCGCCCGCAAAAGCGTG ...
-
bioRxiv - Immunology 2024Quote: pcDNA3.1 plasmids encoding the C9-tagged SARS-CoV-2 S protein (pcDNA3.1-SARS2-S) (Addgene plasmid # 145032)62 ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNAs were amplified from the corresponding pJet1.2 vectors and pPD95.81 (a gift from Andrew Fire (Addgene plasmid # 1497; http://n2t.net/addgene:1497; RRID:Addgene_1497)) was a source of backbone and GFP sequences ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 million HeLa cells were resuspended in 400 μL DMEM with 2 μg SpCas9 plasmid (Addgene, 71814), 500 ng gRNA plasmid ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 μg of a constitutively active PAK1 plasmid (pCMV6M-PAK1 T423E, Addgene plasmid # 12208 by Jonathan Chernoff), or 2 μg of a dominant-negative PAK1 plasmid (pCMV6M-PAK1 H83L H86L K299R ...
-
bioRxiv - Cancer Biology 2024Quote: ... Single-cell clone parental cells were transfected with pSpCas9(BB)-2A-Puro 2 (Addgene Cat No. 48139) that contain guide RNAs that target the intron-exon junction of the second exon of HMCES (5’-TTGCGCCTACCAGGATCGGC and 5’-ACTTTAGACGGTGGTCACGG) ...
-
bioRxiv - Neuroscience 2024Quote: The plasmid WPRE-ab (pAAV/mIba1.GFP.WPRE.miR-9.T.miR-129-2-3p.T.SV40pA) was obtained from previous studies in our laboratory (Addgene plasmid #190163). The plasmid CAG-eYFP-3x-miR708-5p-TS was a gift from Viviana Gradinaru (Addgene plasmid #117381 ...
-
bioRxiv - Developmental Biology 2024Quote: To construct the loop donor cassette vectors the pBS-KS-attB1-2 cloning vector (JN222909.1, Addgene #61255) was cut with NheI and NsiI to obtain a 264bp fragment with the inverted attB sites ...
-
bioRxiv - Biophysics 2023Quote: ... The plasmids for his-FUSLC (residue 1 to 163) and LAF-1 RGG (residue 1 to 168) were acquired from Addgene (https://www.addgene.org/127192/ (Fawzi laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... the left eye was injected with 1 μL of a 1:1 mixture of AAV2/7m8-hSyn-DIO-ChrimsonR-tdTomato (Addgene Plasmid #62723 packaged by BCH viral core ...
-
bioRxiv - Neuroscience 2024Quote: ... PSD-95 (NeuroMab, 1:100 and Addgene 1:100 for SIM experiments), RIM1/2 (SySy ...
-
bioRxiv - Neuroscience 2024Quote: ... a 1:1 mixture of AAV8 Ef1a-CONFON-IC++-eYFP (Addgene #137155) and AAV8 Ef1a-CoffFon2-ChR2-mCherry (Addgene #137134 ...
-
bioRxiv - Neuroscience 2024Quote: ... or at a 1:1 ratio with AAV5-gfaABC1D::hPMCA2-mCherry (Addgene #111568 ...
-
bioRxiv - Cancer Biology 2024Quote: ... pLKO.1 scramble (scr) shRNA and pLKO.1 control shRNA (Addgene, #8453) were used as controls ...
-
bioRxiv - Cell Biology 2024Quote: ... Wildtype full-length beclin-1 cDNA (pcDNA4-beclin-1, Addgene plasmids#24388) was used for plasmid transfection and was cloned into pCDH-CMV-MCS-EF1-GFP lentivector (System Biosciences ...
-
bioRxiv - Cell Biology 2021Quote: ... Raji or SKW6.4) were infected with Cas9 expressing viruses that were produced in HEK293T cells transfected with the lentiCas9-Blast (#849, Addgene plasmid #52962), pMD2.G ...
-
bioRxiv - Neuroscience 2020Quote: 8 weeks old Mrap2fl/fl Mc4regfp females (n=4) were injected unilaterally with pAAV-Ef1a-mCherry-IRES-CRE (Addgene, catalog #55632-AAV8).
-
bioRxiv - Developmental Biology 2023Quote: Riboprobes for in situ hybridization were synthesized using the oligonucleotide primers listed in Supplementary Table 4 to clone the DNA fragment of interest into vector pJC53.2 (Addgene Plasmid ID: 26536), followed by riboprobe synthesis previously described 80.
-
bioRxiv - Cell Biology 2024Quote: ... The fragment encoding the Cerulean gene containing 3xNLS was amplified from the template pCerulean-PCNA-19-SV40NLS-4 (a gift from Michael Davidson; Addgene plasmid # 55437) using primer pair 6380 (5’- GGA GCC TCA GCC GCT TCA GCT GCT CCG GTC GCC ACC ATG GTG AG -3’ ...
-
bioRxiv - Genetics 2024Quote: pCDF5-U6-[4xgRNA-tRNA]-GFP was generated by cloning the 4 gRNAs targeting GFP from (Ma et al., 2016) in pCDF5 (Addgene #Plasmid #73914) (Port and Bullock ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO_HOXB13_#1 (Addgene #70093) and pLKO_HOXB13_#2 (Addgene #70094 ...
-
bioRxiv - Neuroscience 2023Quote: ... CaVα2δ-1 (Addgene, 26575) and eGFP (Clontech ...