Labshake search
Citations for Addgene :
1201 - 1250 of 2537 citations for 2 1H Imidazol 1 yl 6 methyl 4 pyrimidinemethanamine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: IDT gBlock gene fragments encoding WT and mutant SARS-CoV-2 Mac1 were cloned into a BamHI- and EcoRI-linearized pLVX-EF1alpha-nCoV2019-nsp13-2xStrep-IRES-Puro (Addgene, 141379) by Gibson Assembly Cloning reaction (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... sapiens beta-2-adrenergic receptor used as a control in BRET2 experiments was a gift from Robert Lefkowitz (Addgene plasmid #14697). Mm Arr-2 (NP_796205.1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... self-complementary single-stranded DNA oligos (Supplementary Table 2) were annealed and cloned into AgeI/EcoRI sites of Tet-pLKO-puro vector (Addgene, #21915). Tet-pLKO-puro vectors were packaged into a lentivirus system with pCMV-VSV-G (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... We expressed the soma-targeted opsin ST-ChrimsonR 43 in excitatory neurons by injecting a virus (1012 titer; AAV2/2 camKII-KV2.1-ChrimsonR-FusionRed; Addgene, plasmid #102771) into the craniotomy ...
-
bioRxiv - Neuroscience 2023Quote: Viral injections were performed postnatally at P1-2 with in-house produced according to or commercially available viral vectors AAV-php.eB-hSyn-gCamp7f (Addgene Plasmid #104488) or AAV-php.eB-S5E2-ChR2-mCherry (Addgene Plasmid #135634 ...
-
bioRxiv - Microbiology 2023Quote: ... and pRN-Luc (50 ng) reporter plasmids in combination with S protein expressing plasmids pTwist-SARS-CoV-2 Δ18 D614G (Addgene, 164437) or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene ...
-
bioRxiv - Bioengineering 2024Quote: An all-in-one Cas9/gRNA expression construct encoding an AAVS1 sgRNA sequence derived from pCas9-sgAAVS1-2 PX458 (Addgene; 129727) was placed downstream of the hU6 promoter in a PX458 (Addgene ...
-
bioRxiv - Biophysics 2024Quote: ... the HECT domain consisting of residues 615-994 of full-length NEDD4-2 (a gift from Joan Massague, Addgene plasmid # 27000) (66 ...
-
bioRxiv - Biochemistry 2024Quote: Mutations of phosphorylation sites within the SR region were generated via site-directed mutagenesis based on either the tag-free SARS-CoV-2 Nucleocapsid protein plasmid (Addgene, #177937) or the Strep-tagged SARS-CoV-2 Nucleocapsid protein plasmid (Dr ...
-
bioRxiv - Microbiology 2024Quote: ... BHK-21/WI-2 cells were infected with vTF7-3 for 45 min and then transfected with pVSV-EGFP-dG (Addgene 31842) or pVSV-FLuc-dG and pBS vectors encoding the N ...
-
bioRxiv - Molecular Biology 2024Quote: ... and SARS-CoV-2 nsP3 Mac1 (Kind gift by Sarah Knapp, RWTH Aachen) were subcloned into a Sleeping Beauty vector (Addgene #60506). The Sleeping Beauty vector was co-transfected with a Sleeping Beauty Transposase (Addgene #34879 ...
-
bioRxiv - Neuroscience 2024Quote: ... EnvA-N2C-dG-tdTomato (2×109, Center for Neuroanatomy with Neurotropic Viruses, CNNV)m AAV9-hSyn-DIO-hM4d(Gi)-mCherry (Addgene #44362)32 ...
-
bioRxiv - Genetics 2024Quote: Two sgRNAs targeting the start and end of the rme-2 coding sequence were in vitro transcribed from a SP6 transcription template amplified from pDD162 (Addgene #47549) using primers P42 (start sgRNA ...
-
bioRxiv - Molecular Biology 2024Quote: RIF1-/- and RIF1ΔEx32 cells were generated by transient transfection of U-2 OS cells with pX459 vectors (v2, Addgene plasmid #62988) 30,31 harboring two sgRNA sequences targeting RIF1-Ex2 (5’-CACCgAGTCTCCAACAGCGGCGCGA-3’ and 5’-AAACTCGCGCCGCTGTTGGAGACTc-3’ ...
-
bioRxiv - Cancer Biology 2024Quote: A double cutting CRISPR/Cas9 approach with a pair of sgRNAs (sgRNA A and B) was used to completely excise exon 2 (322 bp region) of DYRK1A using a px458 vector (Addgene #48138) that was modified to express the full CMV promoter ...
-
bioRxiv - Neuroscience 2024Quote: ... a small volume of AAV8-hSyn-DIO-hM3D(Gq)-mCherry virus (Addgene 44361, final titer 2 x 1012 pp per mL) was injected bilaterally into RSC (AP ...
-
bioRxiv - Synthetic Biology 2024Quote: The sgRNA oligonucleotides targeting human RAI1 promoter regions were designed using the Benchling gRNA Design Tool.39 The sadCas9-2 × VP64 vector (Addgene #135338)40 was used as a backbone vector ...
-
bioRxiv - Genetics 2024Quote: ... A synthetic gene fragment containing the anti-CRISPR AcrIIa4 codon-optimized for Drosophila was attached downstream of the ϕC31[2] integrase (from pBS130, Addgene # 26290) followed by a P2A site ...
-
bioRxiv - Cell Biology 2024Quote: ... elegans expression plasmid pPD49.26 by PCR and cloned into the pLenti PGK Puro DEST (w529-2) vector backbone (Addgene plasmid # 19068) by MultiSite Gateway cloning according to the manufacturers protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... and 2 (sgRNA-GALC2: 5’ TACGTGCTCGACGACTCCGA 3’) were subcloned individually into pX459 v2.0 (gift from Dr. Feng Zhang, Addgene plasmid #6298832). GALC targeting sequences were further tested by the Off-Spotter software to minimize potential off target effect ...
-
bioRxiv - Cell Biology 2024Quote: ... elegans expression plasmid pPD49.26 by PCR and cloned into the pLenti PGK Puro DEST (w529-2) vector backbone (Addgene plasmid #19068) by MultiSite Gateway cloning according to the manufacturers protocol ...
-
bioRxiv - Cancer Biology 2024Quote: Lentiviral transduction of H7536 thyroid cancer cells was performed as described (32) to express MAX ORF Isoform 2 (NM_145112.2) that was cloned into pCW57-RFP-P2A-MCS (Addgene plasmid no. 78933).
-
bioRxiv - Developmental Biology 2024Quote: ... DICE system was introduced into the H11 locus of NKX2-5eGFP/w using 2 plasmids: one carrying Cas9 nuclease and two guide RNAs (Addgene#164850) and a second one carrying a landing pad (Addgene #51546 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Sense and antisense double strands of the targets A and B (see Supplementary Table 2) were cloned into pU6-BbsI-chiRNA (Addgene #45946) [47] for production of single stranded guide RNAs (sgRNAs ...
-
bioRxiv - Immunology 2021Quote: ... and the third exon of NCR3 (conserved in 3 of the 4 longest isoforms of NCR3 with transcript ID ENST00000376073) were designed and cloned into the lentiCRISPR V2 vector (Addgene #52961, sgRNA sequences in Table S1). Lentiviruses were produced in HEK293T cells using standard laboratory protocols ...
-
bioRxiv - Bioengineering 2020Quote: ... The eluted fractions were then pooled together and underwent TEV cleavage overnight at 4°C (TEV protease was purified using the plasmid pRK793, #8827 from Addgene, a gift from David Waugh Lab).
-
bioRxiv - Neuroscience 2021Quote: pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 (titer ≥ 1×1013 vg/ml, working dilution 1:5) was a gift from Douglas Kim (Addgene viral prep #100833-AAV9 ...
-
bioRxiv - Neuroscience 2020Quote: ... Animals were infused bilaterally with 1 μl of AAV5-hSyn-DIO-hM4Di-mCherry (1012 particles.ml−1, Addgene, Watertown ...
-
bioRxiv - Cell Biology 2023Quote: ... The aqp1a.1 or aqp8a.1 cDNA was subcloned into pmCherry-N1 or pEGFP-N1 vector (Addgene). Human retinal microvascular endothelial cells (HRMECs ...
-
bioRxiv - Cancer Biology 2023Quote: shRNA sequences targeting LINE-1 ORF169 were cloned into pLKO.1-TRC cloning vector (Addgene, cat# 10878) using EcoR1 and AgeI restriction enzyme digestion ...
-
bioRxiv - Biophysics 2021Quote: Clones of MDCKII expressing GFP-myosin-2-A were created by transfecting cells with pTRA-GFP-NMCH II-A plasmid (Addgene plasmid # 10844). Stable expressing clones were selected via Neomycin resistance (G418) ...
-
bioRxiv - Molecular Biology 2021Quote: ... sgRNA against exon 23 (Table 2) was cloned downstream of the U6 promoter of the pSpCas9(BB)-2A-GFP (PX458) plasmid (Addgene plasmid # 48138) 61 ...
-
bioRxiv - Biophysics 2022Quote: HEK 293T cells were co-transfected with either pmNG-Mpro-Nter-auto-NLuc or pmNG-Mpro-Nter-auto-L-NLuc plasmid along with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2xStrep-IRES-Puro (Mpro WT) (Addgene plasmid # 141370) or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (Mpro C145A ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... dUP-Cd63 and dUP-Myt1l (2 mg/ml, subcloned from double UP mClover to Scarlet, Addgene #125134, Taylor et al., BioRxiv 2019); DFRS ...
-
bioRxiv - Bioengineering 2021Quote: HDM-SARS2-Spike-delta21 and HDM-SARS2-Spike-del21-614G encoding SARS-CoV-2 Spike with 21 amino acid C-terminal deletion for lentiviral pseudo-typing were purchased from Addgene (Watertown, MA) with serial numbers of Addgene #155130 and Addgene#158762 ...
-
bioRxiv - Biochemistry 2021Quote: ... Nsp14 was subcloned into a modified pBIG1a vector containing a pLIB-derived polyhedrin expression cassette to either contain an N-terminal 3xFlag-6His tag (sequence: MDYKDHDGDYKDHDIDYKDDDDKGSHHHHHHSAVLQ-nsp14) or no tag to generate SARS-CoV-2 nsp14/nsp10-His-3xFlag (Addgene ID 169164). Baculoviruses were generated and amplified in Sf9 insect cells (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 + 3 gRNAs targeting either side of the +3 kb enhancer core region (targeting sequences listed in Supplementary Table 2) were cloned into pX330 vector (Addgene plasmid #42230). mESCs were co-transfected with a mixture of all 6 CRISPR plasmids and a plasmid containing a blasticidin expression cassette for selection ...
-
bioRxiv - Cell Biology 2021Quote: ... LifeAct mScarlet cell lines were generated by electroporating 2 μg/ml of pLifeAct-mScarlet-N1 plasmid DNA (a gift from Dorus Gadella, Addgene plasmid 85054) into WT and CD56-KO NK92 cells using the Amaxa nucleofector (Kit R ...
-
bioRxiv - Neuroscience 2021Quote: ... C57BL/6J mice received unilateral injections of AAVrg-CaMKIIα-mCherry (200 nl at 200 nl/min, titer 2×1013 vg/ml, #114469-AAVrg, Addgene, MA, USA) into the right main OB (0.5 mm lateral from midline ...
-
bioRxiv - Cell Biology 2022Quote: ... INS-1 832/3 EV or g1-2 SNAP-GLP-1R cells were transfected with the pCI HA NEDD4 construct (a gift from Prof. Joan Massague, Addgene plasmid #27002) 24 hours before the experiment ...
-
bioRxiv - Cell Biology 2022Quote: ... The S1R-Apex and GFP-Apex plasmids were co-transfected into either HeLa cells (ATCC; CCL-2) or HEK293T cells (ATCC; CRL-3216) along with pXAT2 (Addgene plasmid 80494) (30) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Clones were generated using oligonucleotide primers listed in Supplementary Table 2-3 to amplify the gene fragment from cDNA and cloned into the vector pJC53.2 (Addgene Plasmid ID: 26536)60 ...
-
bioRxiv - Systems Biology 2020Quote: ... Cells were transformed by standard lithium acetate methods to fluorescently labelled indicated organelles with monomeric Kusibara Orange 2 (mKO2) obtained from Addgene (Cambridge, MA). Peroxisomes in strains engineered with deletions of DNM1 ...
-
bioRxiv - Biochemistry 2021Quote: ... Templates used to create the PCR fragments were pTwist-EF1alpha-SARS-CoV-2-S-2xStrep (gift from Nevan Krogan; Addgene plasmid #141382), pCEP4-myc-ACE2 (gift from Erik Procko ...
-
bioRxiv - Cancer Biology 2022Quote: ... and exon 5: AGCCCAAGGATGCCAGCCAG (guide 2) were ordered from IDT (Leuven, Belgium) and cloned into pSpCas9(BB)-2A-GFP(PX458) (Addgene Teddington, UK), according to the protocol of Ann Ran et al ...
-
bioRxiv - Microbiology 2024Quote: The viral 5′UTR reporter constructs were synthesized using GeneArt and cloned into pLV-SARS-CoV-2 5′UTR-Luciferase (Addgene Cat#191480)32 using NdeI and BsaBI ...
-
bioRxiv - Biochemistry 2024Quote: ... Lentiviral particles were produced in HEK293 cells after transient transfection of the packaging vectors psPAX.2 and pMD.G2 (Addgene #12260 and #12259). After viral transduction ...
-
bioRxiv - Immunology 2024Quote: ... were carried out as following: MaSCs (passage 2-3) were transduced with sgP53 or sgNT cloned into lentiCRISPRv2-puro (Addgene, Plasmid #98290), passaged once ...
-
bioRxiv - Microbiology 2023Quote: The ISRE-Luc reporter plasmid (32) (25 ng) was either transfected alone or co-transfected with a plasmid expressing SARS-CoV-2 genes NSP13 (Addgene, cat. 141379) (25 ng) ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSCs were transfected with LSD-dCas9-BFP-KRAB and TALENS targeting the human CLYBL safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using transfection reagent ...