Labshake search
Citations for Addgene :
1001 - 1050 of 1731 citations for 1 1' Diethyl 4 4' bipyridinium dibromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... and ASW (Uniprot Q9BVC5-1) were subcloned into the UC Berkeley MacroLab 438B (Addgene plasmid #55219), 438Rgfp (Addgene plasmid #55221) ...
-
bioRxiv - Biochemistry 2021Quote: ... and ASW (Uniprot Q9BVC5-1) were subcloned into the UC Berkeley MacroLab 438A (Addgene plasmid #55218) plasmid along with sequences encoding N-terminal affinity/fluorescence tags ...
-
bioRxiv - Microbiology 2020Quote: ... pLenti CMV Blast DEST (706-1) (a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17451)) constructs carrying a human Plxdc1-TwinStrep or Plxdc2-TwinStrep expression cassette (pLenti-CMV-Blast-Plxdc1-Strep/ pLenti-CMV-Blast-Plxdc2-Strep ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2012) were cloned into the pLKO.1-Puro vector (a gift from R. Weinberg; Addgene #8453) to generate pLKO.1-Cys-TD and pLKO.1-Scr-TD ...
-
bioRxiv - Immunology 2021Quote: ... Guide 1 (TGTTGGGGAACATATGACAC) and Guide 2 (AAGGAAAAATTCAAACAAGG) sequences were cloned into lentiGuide-puro plasmid (Addgene, #52963), transformed in Stbl3 bacteria (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... Major changes to the reported protocol included: 1) Use of a 2nd generation psPAX2 (Addgene, #12260) lentivirus packaging system instead of the 3rd generation system used by the Bloom lab ...
-
bioRxiv - Neuroscience 2023Quote: ... 600 nL (in AuCx) or 1 µL (in IC) of AAV1-hSyn-hChR2(H134R)-EYFP (Addgene, Item# 26973-AAV1 ...
-
bioRxiv - Neuroscience 2023Quote: ... For anterograde transsynaptic tracing: AAV1-hSyn-Cre-WPRE-hGH (1013 gc/ml, Addgene; 1:10 dilution) was injected in DCN (coordinates as above) ...
-
bioRxiv - Molecular Biology 2023Quote: ... as well as overhangs for assembly into the STARR-seq vector (Addgene #99296; Supplemental Table 1) according to the manufacturer’s instruction (10 to 11 cycles of amplification) ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice were injected with ∼2000 nl of a 1:6 ratio of AAV1-Syn-Cre (AAV.hSyn.Cre.WPRE.hGH, 105553-AAV1, Addgene) and AAV1-CAG-tdTomato (59462-AAV1 ...
-
bioRxiv - Neuroscience 2023Quote: PV-IRES-Cre mice were injected with AAV2/8.CAG.Flex.eGFP (Addgene, titer ≥ 1×10¹³ vg/mL) anterograde tracing virus in the HDB (antero-posterior ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV1-hSyn-GCaMP7b (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 in saline) for imaging of pulvinar axons ...
-
bioRxiv - Genetics 2023Quote: ... and the annealed sense and antisense shRNA oligonucleotides were cloned into pLKO.1-puro vector (Addgene) for knockdown of human KISS1 ...
-
bioRxiv - Neuroscience 2022Quote: ... adeno-associated virus AAV8 carrying CaMKII-GCaMP6f (pENN.AAV.CamKII.GCaMP6f.WPRE.SV40. Addgene. #100834. 1×1012 genome copies per ml) was injected with Nanoject-III (Drummond Scientific Company ...
-
bioRxiv - Molecular Biology 2022Quote: ... was used per manufacturer’s instruction to add 1 µg of the mRFP-UtrCH plasmid (Addgene #26739) to both WT and PDKO T-REx-293 cells seeded in 6-well plates at ∼70% confluency ...
-
bioRxiv - Cancer Biology 2022Quote: ... Annealed gRNA oligos were ligated to pLKO.1-puro U6 sgRNA BfuAI stuffer (Addgene plasmid #50920), and lentiviral particles were generated ...
-
bioRxiv - Developmental Biology 2023Quote: Lentiviral shRNA expression constructs were generated by first modifying the pLKO.1 puro vector (Addgene #8453), digesting with BamHI and KpnI and replacing the puromycin resistance cassette with an mCherry coding sequence.
-
bioRxiv - Neuroscience 2024Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... F-tractin and Linker 1 were derived from pEGFP-C1 F-tractin-EGFP (Addgene Plasmid #5847)48 ...
-
bioRxiv - Neuroscience 2023Quote: ... Addgene #55639 (packaged in AAV2/1) AAV2/8-EF1a-fDIO-ChrimsonR-mRuby2-KV2.1TS modified from Addgene #124603 pAAV-hSyn1-SIO-stGtACR2-FusionRed ...
-
bioRxiv - Biochemistry 2023Quote: ... Mouse H2A.Z.1 gene in pIND-EGFP was a kind gift from from Danny Rangasamy (Addgene plasmid # 15770 ...
-
bioRxiv - Neuroscience 2023Quote: Heterozygous ChAT-Cre mice were bilaterally injected with 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5) in basal forebrain (AP ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Human FUS (residues 1-214) was amplified by PCR using pHR-FUSN-mCh-Cry2WT (Addgene #101223). The IDRs fragments were fused with TPPPCORE domain(aa.45-166 ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3.1 Dynamin 1 (human, p880) was a gift from Sandra Schmid and was obtained from Addgene (Addgene plasmid #34682 ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1 and pLKO.5 were sourced from Addgene (#1864; a gift from David Sabatini 9) and Sigma-Aldrich (St ...
-
bioRxiv - Neuroscience 2022Quote: ... mice were infused with diluted (1:5) or undiluted virus pAAV5-CAMKIIa-(hChR2- H134R)-eYFP (Addgene-ChR2 titre ...
-
bioRxiv - Cell Biology 2022Quote: ... The GFP-RIAM(1-666) construct was a gift from Chinten James Lim (Addgene plasmid 80028) (Lee et al. ...
-
bioRxiv - Genetics 2022Quote: ... Transfection mix for each shRNA contained 8.75μg of shRNA targeting construct in pLKO.1 (Addgene#8453), 8.75μg psPAX2 (Addgene#12260 ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-CAG-Flex.GCaMP6f.WPRE (3.15×1013 vg/ml, working dilution 1:10, Addgene plasmid #100835-AAV5; http://www.addgene.org/100835/; RRID:Addgene_100835) was a gift of Douglas Kim and GENIE Project ...
-
bioRxiv - Developmental Biology 2023Quote: H2B-EGFP mRNA was transcribed from plasmid #1 pCS-H2B-EGFP (Megason, 2009) (Addgene, Plasmid #53744). To construct pCS2-myrTagRFP-T (plasmid #2) ...
-
bioRxiv - Genetics 2023Quote: pHarvester was generated using pCFD5-gRNA#1&2 and pnos-Cas9-nos plasmids (Addgene no: 62208). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: ... Both pie-1p and pie-1 3’UTR PCR products were amplified using pPK605 plasmid (Addgene) as the template.
-
bioRxiv - Cancer Biology 2023Quote: SNAIL and SLUG knockout PANC-1 cell lines were generated using lentiCas9-Blast (Addgene plasmid 52962) and lentiGuide-Puro (Addgene plasmid 52963 ...
-
bioRxiv - Microbiology 2024Quote: GECs were transfected with 1 µg of pFLAG-CMV2-Hsp27-S78D/S82D (Addgene plasmid # 85187 [69]), a constitutively activated HSp27 construct ...
-
bioRxiv - Molecular Biology 2024Quote: Endogenous gene silencing was achieved via lentiviral infection using the pLKO.1-blast vector (Addgene #26655) to express corresponding shRNAs ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... An AAV9 expressing GCaMP6f under a CaM Kinase II promoter (pENN.AAV9.CamKII.GCamp6f.WPRE.SV40, titer ≥ 1×10¹³ vg/mL, Addgene) was then injected bilaterally into the medial prefrontal cortex (mPFC) ...
-
bioRxiv - Cell Biology 2024Quote: ... The pLentiDest-IER3IP1 shRNA#1 construct along with the three packaging vectors p-VSVG (Addgene 8454), pRSV (Addgene 12253) ...
-
bioRxiv - Neuroscience 2024Quote: ... All shRNA plasmids were made by digesting pLKO.1 hPGK-BFP TRC cloning vector (Addgene #191566) with AgeI-HF and EcoRI-HF and ligating annealed shRNA sequences with Quick Ligase Buffer (NEB ...
-
bioRxiv - Neuroscience 2024Quote: Primary rat hippocampal neurons at DIV3 were infected with pLKO.1-TRC mTagBFP2 (Addgene, plasmid #191566) to express JPH3 shRNA (from OrigGene ...
-
bioRxiv - Cancer Biology 2024Quote: The shRNA sequences were inserted into the pLKO.TRC.1 plasmid (Addgene, Cat#10878, RRID: Addgene_10878, Addgene).
-
bioRxiv - Cancer Biology 2024Quote: The shRNA sequences were inserted into the pLKO.TRC.1 plasmid (Addgene, Cat#10878, RRID: Addgene_10878, Addgene).
-
bioRxiv - Neuroscience 2024Quote: All shRNA plasmids were made by digesting pLKO.1 hPGK-BFP TRC cloning vector (Addgene #191566) with AgeI-HF and EcoRI-HF and annealed shRNA sequences were ligated with Quick Ligase Buffer (NEB) ...
-
bioRxiv - Neuroscience 2024Quote: ... The AAV11 capsid gene58 was synthesized and inserted into the pAAV2/1 helper vector (Addgene #112862). The following viruses were used in this study ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1 μl of AAV1 particles with pAAV.Syn.NES-jRGECO1a.WPRE.SV40 (at titer ≥ 1 × 1010 vg/ml) (both from Addgene). Neurons had significant ChR2 and jRGECO1a expression by day in vitro (DIV ...
-
bioRxiv - Neuroscience 2024Quote: AAV5-GfaABC1D-mCherry-hPMCA2w/b (1 µl/hemisphere; 1.0 × 1013 viral particles/ml; Addgene #111568-AAV5) (Yu et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... each mouse was transfected with a 400 nl injection of the calcium reporter GCaMP8f via the viral construct AAV9.syn.GCaMP8f.WPRE.SV40 with an original titre of 2.3 x 1013 GC ml-1 (Addgene) diluted at a 1 part virus to 7 parts sterile artificial cerebrospinal fluid before surgical microinjection.
-
bioRxiv - Neuroscience 2024Quote: ... Eurogen Cat.# FP741) and AAV9-gfaABC1D-eGFP (2.42 x 1011 gc/ml-1, Addgene Cat.# 176861)45 were delivered to the coordinates (AP -2.3 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The shRNAs targeting CBP and P300 were cloned into pLKO.1-TRC lentiviral vector (Addgene, #10878). The primers and oligonucleotides used in this study are listed in Supplementary Table 3 ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 × 106 cells were co-transfected with 5 µg of eSpCas9-hGeminin plasmid (Addgene plasmid, #86613) and 5 ug of ATP1A1_plasmid_donor_RD (Addgene plasmid ...
-
RNA Binding of GAPDH Controls Transcript Stability and Protein Translation in Acute Myeloid LeukemiabioRxiv - Cancer Biology 2024Quote: ... THP-1 Jurkat and CUTLL1 with a lentiviral Cas9 construct and blasticidin resistance marker (Addgene #52962). Cell lines were transduced with the RBP library at a low MOI (∼0.3) ...