Labshake search
Citations for Addgene :
951 - 1000 of 1553 citations for 5 Bromo 2 Tert Butyldimethylsilyl 4 Methylthiazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... 2 × 104 HEK293T target cells transfected with 500 ng of a human ACE2 expression plasmid (Addgene) were seeded in a white flat-bottom 96-well plate one day prior to the assays ...
-
bioRxiv - Biophysics 2023Quote: Dendra-2 EEA1 was generated by replacing TagRFP-T in RagRFP-T EEA1 (Addgene plasmid #42635) at cloning sites AgeI and XhoI ...
-
bioRxiv - Genetics 2023Quote: ... All the plasmids developed in this work (Table 2) will be available from Addgene (Massachusetts, USA) once the manuscript is accepted for publication.
-
bioRxiv - Biochemistry 2023Quote: ... SARS-CoV-2 Mac1 without CFP-tag was cloned and expressed from pNH-TrxT (Addgene #173084).
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 whole spike protein HexaPro was a gift from Jason McLellan (Addgene plasmid # 154754). SARS-CoV-2 HexaPro was expressed in Expi293F cells and purified with Ni-NTA resin followed by size exclusion as described previously [61] ...
-
bioRxiv - Cancer Biology 2023Quote: ... Vectors used included pGIPZ-GFP-Puro (see Supplementary Materials) and psPAX.2 and pMD2.G (Addgene). Cell transfections were done in Opti-MEM (Life Technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: Heterozygous ChAT-Cre mice were bilaterally injected with 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5) in basal forebrain (AP ...
-
bioRxiv - Microbiology 2024Quote: Mammalian expression vectors used were pcDNA3.1-Ha-Dynamin 2.WT (gift of S. Schmid; Addgene 34684), pcDNA3.1-Ha-Dynamin 2.K44A (gift of S ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligonucleotides were annealed and cloned in BsmBI–digested lentiCRISPRv.2-puro plasmid (catalogue no. 52961; Addgene). Lentiviral particles for cloned lentiCRISPRv.2 were generated by transfecting human embryonic kidney (HEK ...
-
bioRxiv - Genetics 2023Quote: pHarvester was generated using pCFD5-gRNA#1&2 and pnos-Cas9-nos plasmids (Addgene no: 62208). Briefly ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/2-hsyn-DIO-hM4D(Gi)-mCherry was obtained from Addgene (plasmid #44362, 4.6x1012 GC/ml). For optogenetic activation ...
-
bioRxiv - Molecular Biology 2024Quote: ... nsp1 coding sequences were amplified by PCR from pDONR207 SARS-CoV-2 nsp1 (WT, Addgene #141255), pDONR207 SARS-CoV-2 nsp1 Delta RC (M1 ...
-
bioRxiv - Neuroscience 2024Quote: ... rats received bilateral 2 uL viral injections of rAAV5 pZac2.1-GfaABC1D-Rpl22-HA (Addgene cat #111811) into the nucleus accumbens (6° angle ...
-
bioRxiv - Microbiology 2024Quote: ... iBMDM cell suspensions were mixed with 2 µg of pEGFP VAMP2 (mouse; Addgene plasmid # 42308 (51). Cells were electroporated using the program FF-100 and immediately transferred to pre-warmed DMEM ...
-
bioRxiv - Bioengineering 2024Quote: For transgene expression studies with AAV vectors we used the following AAV expression plasmid:pAAV/mIba1.GFP.WPRE.miR-9.T.miR-129-2-3p.T.SV40pA was a gift from Hirokazu Hirai (Addgene plasmid # 190163; http://n2t.net/addgene:190163; RRID:Addgene_190163)(1) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... pcDNA3-SARS-CoV-2-S-RBD-sfGFP was a gift from Erik Procko (Addgene plasmid #141184), and a his-tag was added to the C-terminus of the RBD-sfGFP open reading frame (ORF) ...
-
bioRxiv - Developmental Biology 2021Quote: For mammalian 2-hybrid assays 2.15 x 105 HEK293 or 4 x 105 A375 cells were transiently transfected with 1 µg firefly luciferase reporter plasmid (5xGAL4-TATA-luciferase, Addgene, 46756) (Sun et al ...
-
bioRxiv - Neuroscience 2022Quote: ... 90ul cells suspension containing 1M cells was mixed with 10 uL DNA mix: 4 ug pSpCas9(BB)-2A-Puro (PX459) plasmid (Addgene #48139), • 0.4 ug gRNA encoding plasmid (pKLV-U6gRNA(BbsI)-PGKzeo2ABFP ...
-
bioRxiv - Molecular Biology 2021Quote: We performed a genome-wide CRISPR knock-out (KO) screen using the lentiviral Brie sgRNA library comprising 4 sgRNAs per protein-coding gene (Addgene #73632) (Doench et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... the fibroblasts were reprogrammed using the three plasmids (pCXLE-hOct3/4 [Addgene #27076], pCXLE-hSK [Addgene #27078], pCXLE-hUL [Addgene #27080]) with 10ug of each plasmid through the Amaxa Nucleofector (Lonza) ...
-
bioRxiv - Neuroscience 2020Quote: ... the fibroblasts were reprogrammed using the three plasmids (pCXLE-hOct3/4 [Addgene #27076], pCXLE-hSK [Addgene #27078], pCXLE-hUL [Addgene #27080]) with 10ug of each plasmid through the Amaxa Nucleofector (Lonza) ...
-
bioRxiv - Neuroscience 2021Quote: ... The patient-specific iPSCs were generated from LCLs by transfection with a combination of episomal plasmids (pCE-hOCT3/4, pCE-hSK, pCE-hUL, and pCE-mp53DD) (Addgene Inc.), as previously reported (Barrett et al ...
-
bioRxiv - Biophysics 2020Quote: ... A homozygous clone that passed all QC (U2OS HP1⍺ 4) was co-transfected with the transposon vector pEF1a-OsTIR-IRES-NEO-pA-T2BH (Addgene 127910) and SB100X in pCAG globin pA (Addgene 127909) ...
-
bioRxiv - Biochemistry 2022Quote: ... All plasmids generated by this study have been deposited to Addgene for distribution (See Supplemental Table 4 for Addgene accession numbers).
-
bioRxiv - Neuroscience 2021Quote: HEK293 cells were transfected with 500 ng of equimolar pooled SCN1A_h1b sgRNAs (Table 4) and 500 ng dCas9p300Core (Addgene, plasmid #61357) using Lipofectamine 3000 ...
-
bioRxiv - Immunology 2021Quote: ... Platinum-E cells were transfected at 70-80% confluency on 10 cm plates with 4 μg pCL-Eco(40) and 6 μg of either pMSCV-pBabeMCS-IRES-RFP (Addgene; 33337) or pMSCV-Myc-IRES-RFP (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: The CD34+ cells were cultured in the expansion medium for 3-days and then nucleofected with episomal reprogramming plasmids (pCXLE-hOCT3/4-shp53 (Addgene: 27077), pCXLE-hSK (Addgene 27078 ...
-
bioRxiv - Neuroscience 2023Quote: ... we generated small guide RNAs to PAM sites in proximity to exons 4 and 7 of the murine Grik3 locus and cloned these into the pSpCas9(BB)-2A-GFP (PX458) backbone (Addgene #48138), where expression of the sgRNAs is controlled under the U6 promoter ...
-
bioRxiv - Cell Biology 2024Quote: ... The hDLXI56i enhancer was originally obtained from CN1851-rAAV-hI56i-minBglobin-iCre-4×2C-WPRE3-BGHpA (Graybuck et al., 2021) (Addgene #164450).
-
bioRxiv - Cancer Biology 2023Quote: ... they were transduced with lentivirus containing pLenti_CMV_GFP_Hygro [pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene viral prep #17446-LV)] at a multiplicity of infection of 10 for 48 hours before washing with PBS and replacing with fresh medium ...
-
bioRxiv - Developmental Biology 2022Quote: ... 35 μl of hot glycerol was cooled to 4°C then 35 μl of the primer mixture and 25 μl of Tn5 (Addgene #112112) was added and mixed and held at 1 hr at RT with gentle pipet mixing every 15 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Retrovirus expressing NFAT1-GFP was constructed by inserting BglII/HpaI NFAT1-GFP fragment from HA-NFAT1(4-460)-GFP plasmid (Addgene #11107) into BglII/HpaI sites of pMSCV-Blasticidin plasmid (addgene #75085 ...
-
bioRxiv - Systems Biology 2022Quote: ... and added undiluted to K562 cells for a final cell concentration of 3-4 x 105 cells/mL for pJT126-based effector recruitment vectors (Addgene #161926) or 1-2 x 105 cells/mL for pCL040-based inducible protein expression vectors (to be deposited on Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... The sensing domain for citrate comprised residues 4–133 of the CitAP domain from Klebsiella pneumoniae CitA protein (Addgene plasmid #134301). The sensing domain for glucose comprised residues 24–328 of the bacterial D-galactose-binding periplasmic protein (MglB ...
-
bioRxiv - Bioengineering 2024Quote: ... The four control plasmids were cloned via ligation of annealed oligonucleotides (Supplementary Table 4) into p11-lacY-wtx1 (Addgene ID 69056) digested with EcoRI-HF ...
-
bioRxiv - Cancer Biology 2024Quote: ... and eGFP cDNA (without 1st ATG) were linked using 4 amino acid “DLEL” and subcloned into pLenti-CMV-EGFP-Blasticidin lentiviral vector (Addgene, 17445) backbone ...
-
bioRxiv - Cell Biology 2024Quote: Brunello genome-wide sgRNA library containing an average of 4 sgRNAs per gene and 1000 non-targeting control sgRNAs was purchased from Addgene (73178). The library was transformed into electrocompetent cells (Lucigen 60242-1 ...
-
bioRxiv - Cell Biology 2024Quote: ... Lentivirus particles were generated by co-transfecting HEK293FT cells (10 cm dish at 80% confluency) with 6 μg of lentiviral overexpression plasmid with 4 μg psPAX2 packaging plasmid (Addgene #12260) and 0.8 μg pMD2.G envelope plasmid (Addgene #12259 ...
-
bioRxiv - Developmental Biology 2020Quote: The zebrafish gfap promoter 51 was derived from the Addgene plasmid: pEGFP-gfap(Intron1/5’/Exon1-zebrafish) (Addgene, #39761) and lssmKate2 65 was derived from the Addgene plasmid ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA targeting CDK12 (5’-GTGGACAAGTTTGACATTAT-3’) was cloned into the pSpCas9(BB)-2A-eGFP (PX458) vector (Addgene 48138). For CDK12 G731E/R knock-in ...
-
bioRxiv - Neuroscience 2020Quote: ... The βIII-spectrin target sequence (5’-GAGACCTGTACAGCGACCTG-3’) was inserted into pSpCas9(BB)-2A-GFP (PX458) (Addgene plasmid #48138) (Ran et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... gRNA_P2_2R: 5’-GCAGTCAAATGAACAGACGC-3’) into pX330-U6-Chimeric_BB-CBh-SpCas9 vector which digested with BbsI from Feng Zhang (Addgene plasmid # 42230 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells settled to the bottom of the well for 5 minutes at room temperature and then 0.25 μL of F-OKMS lentiviral mix (1:1 of Addgene plasmids 51543 ...
-
bioRxiv - Bioengineering 2022Quote: ... and LT1 (305 μL) was combined with a DNA mixture of the packaging plasmid pCMV_VSVG (Addgene 8454, 5 μg), psPAX2 (Addgene 12260 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Addgene plasmid # 12456) and 5 ng of Renilla luciferase control plasmid (a gift from David Bartel; Addgene plasmid # 12179) in each well ...
-
bioRxiv - Cell Biology 2022Quote: ... The lentiviral particles of shZDHHC5 (target sequence 5’CCCAGTTACTAACTACGGAAA3’ in pLKO.1 vector) and empty pLKO.1 (Addgene, 8453) were packaged in HEK293T cells and used to transduce PCDH7-GFP-BAC cells ...
-
Loss of TREM2 reduces hyperactivation of progranulin deficient microglia but not lysosomal pathologybioRxiv - Neuroscience 2021Quote: ... and 5 mg sgRNA cloned into the BsmBI restriction site of the MLM3636 plasmid (gift from Keith Joung, Addgene plasmid #43860 ...
-
bioRxiv - Cell Biology 2021Quote: Embryonic fibroblasts were generated from RHBDL4 WT and RHBDL4 KO E14.5 embryos and immortalized using lentiviral transduction of SV40 virus large T antigen (Ef1a_Large T-antigen_Ires_Puro, Addgene plasmid 18922), as described by Christova et al ...
-
bioRxiv - Neuroscience 2022Quote: ... and 210nl of Arch 3.0- eYFP (rAAV2-EF1a-double floxed-eArch3.0-eYFP; 5 × 1011 GC per ml; UNC Vector Core or eYFP (Addgene plasmid 20296 ...