Labshake search
Citations for Addgene :
1101 - 1150 of 1553 citations for 5 Bromo 2 Tert Butyldimethylsilyl 4 Methylthiazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... The guide sequence used was 5’-TCTCTGAGTGCCAACGCGCG-3’ and was cloned into the BbsI site of pX459 vector (Addgene #62988). The gene targeting was performed by co-transfection of pX459 and the synthetic donor vector into B6N 6.0 embryonic stem cells using Lipofectamine 2000 ...
-
bioRxiv - Biochemistry 2023Quote: ... IGF2BP3: 5’-ACGCGTAGCCAGTCTTCACC-3’) were cloned into the pSpCas9 (BB)-2A-GFP (PX458) (plasmid #48138; Addgene, (Ran et al. 2013)) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The AND gate constructs were optimized by making constructs with ribosome binding site library (5’-GAAAGANNNGANNNACTA-3’) in front of regulators in chemically competent Marionette Clo cells prepared from Addgene [40] ...
-
bioRxiv - Genomics 2024Quote: ... 20Q1 Cancer Dependency Map common essential genes (https://depmap.org/portal/download/) and (ii) 5% non-targeting control sgRNAs cloned into pJR101 (Addgene #187241). A second sgRNA library (dJR092 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the HDR donor plasmid derived from Mouse 5’ Npm1-AID-GFP-PuroR plasmid (a gift from Mark Groudine, Addgene plasmid #127899 ;http://n2t.net/addgene:127899 ...
-
bioRxiv - Molecular Biology 2024Quote: ... ESCs were co-transfected with a plasmid expressing Cas9 protein and the gRNA sequence targeting the NPM1 locus (pX330 Mouse 5’ Npm1 gRNA, a gift from Mark Groudine, Addgene plasmid #127900 ...
-
Autophagy suppression in DNA damaged cells occurs through a newly identified p53-proteasome-LC3 axisbioRxiv - Cell Biology 2024Quote: ... monolayers of HCT116 cells incubated at 37 °C and under 5% CO2 were transfected with RedTrackCMV (vector control; #50957, Addgene) or RedTrackCMV-LC3B (RedTrackCMV containing the gene encoding LC3B ...
-
Autophagy suppression in DNA damaged cells occurs through a newly identified p53-proteasome-LC3 axisbioRxiv - Cell Biology 2024Quote: ... monolayers of HCT116 cells incubated at 37 °C and under 5% CO2 were transfected with RedTrackCMV (vector control; #50957, Addgene) or RedTrackCMV-LC3B (RedTrackCMV containing the gene encoding LC3B ...
-
bioRxiv - Cancer Biology 2024Quote: 5’ UTR elements or part of the GAPDH gene body102 were cloned into the dual luciferase assay construct (Addgene:45642). 1.5 million cells/6cm plate were transfected with 2μg of the construct using lipofectamine 2000 at a ratio of 3:1 lipofectamine to μg DNA ...
-
bioRxiv - Molecular Biology 2024Quote: We cloned two previously published gRNA sequences (13) targeting 5’ or 3’ of the SCR into a Cas9 expressing px330 backbone (#158973, Addgene) according to the protocol published by the Zhang lab (38) ...
-
bioRxiv - Molecular Biology 2024Quote: To generate CRISPR/Cas9-mediated knockout lines, the sgRNA targeting TRIM37 (TRIM37Δ, 5′-ctccccaaagtgcacactga-3′) was cloned into the PX459 vector (#62988; Addgene) containing a puromycin resistance cassette ...
-
bioRxiv - Cancer Biology 2024Quote: ... targeting a DNA sequence within the first exon of the FasL gene (5’-CTGGGCACAGAGGTTGGACA-3’) was cloned into the BsmBI restriction site of the 3rd generation LentiCRISPR.V2 (Addgene, #52961) vector ...
-
bioRxiv - Neuroscience 2024Quote: A small craniotomy was drilled above the right Anterior Cingulate Cortex (AP: +1, ML: -0.3, DV: -0.9) and 0.2μl of AAV1-CAG-tdTomato (59462-AAV1, Addgene, 5×10¹² vg/mL) was injected at a rate of 0.05μl/min ...
-
bioRxiv - Neuroscience 2024Quote: ... A virus lacking the Arch-T gene and instead containing the fluorescent tag eYFP (n=5, AAV9-CaMKIIa-EYFP, packaged by Addgene) was infused into ACC as a null virus control ...
-
bioRxiv - Biochemistry 2024Quote: ... An oligonucleotide corresponding to a target sequence near the smo-1 translational start site (sgRNA #1: 5‘ GCCGATGATGCAGCTCAAGC 3‘) was cloned into the plasmid pMW46 (derivate of pDD162 from Addgene). The deletion of the eleven amino acids ADDAAQAGDNA at the SMO-1 N-terminus was achieved using the oligonucleotide pAF64 as repair template ...
-
bioRxiv - Cancer Biology 2024Quote: Construction of JMJD6-V5 plasmid was previously summarized and pDEST Myc (#19878) tagged YBX1 plasmid was purchased from Addgene (5). PCR based deletion constructs of JMJD6 and YBX1 were made using primers described in Supplementary table 1 ...
-
bioRxiv - Bioengineering 2024Quote: ... the kanamycin-resistance gene AphAI flanked by an I-SceI restriction site (I-SceI-AphAI fragment) was amplified using primers 5 and 6 listed in Supplementary Table 1 from pEPkan-S (Addgene plasmid #41017 ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells at 80-90% confluence were transfected with 2.5-5 µg of plasmid DNA (pcDNA3-EGFP-Cdc42-wt, Addgene #12975) or 50-100 nM siRNA (CdGAP Smart pool or Cdc42 siRNA ...
-
bioRxiv - Cancer Biology 2024Quote: 5 x 106 B-ALL cells (NALM6, REH or SUP-B15) were transduced with lentivirus expressing IKZF1 specific (Addgene #69041) or scramble (Addgene #69040 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentivirus particles for CRISPR-dCas9-directed knockdown of b2m were generated after subcloning a 20 nt sequence (5’ GCC-GTC-GGG-AAG-GAG-AAC-TA-3’ against the 5’- UTR of b2m into pLV-hU6-sgRNA hUBC-dCas9-KRAB-T2a-Puro (gift from Charles Gersbach, Addgene plasmid # 71236 ...
-
bioRxiv - Cell Biology 2020Quote: ... Beta-2-adrenergic receptor-CFP was a gift from Catherine Berlot (Addgene plasmid # 55794; http://n2t.net/addgene:55794; RRID:Addgene_55794) 39 ...
-
bioRxiv - Neuroscience 2022Quote: The pCMV-hEAAT2 plasmid encoding the human excitatory amino acid transporter type 2 (EAAT2) was a gift from Susan Amara (Addgene plasmid # 32814; http://n2t.net/addgene:32814; RRID:Addgene_32814). The cDNA was subcloned into pcDNA3 between KpnI and XbaI restriction sites and under the T7 promoter for expression in Xenopus laevis oocytes ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids pLVX-EF1alpha-SARS-CoV-2-proteins-2xStrep-IRES-Puro proteins are a gift from Nevan Krogan (Addgene)(Gordon ...
-
bioRxiv - Neuroscience 2021Quote: ... The SARS-CoV-2 S-6P plasmid was a gift from Jason McLellan (Addgene plasmid # 154754; http://n2t.net/addgene:154754; RRID:Addgene_154754) 30 ...
-
bioRxiv - Immunology 2021Quote: SARS CoV-2 pseudotyped lentiviruses were produced by transfecting the 293T cells with the pLenti-Puro vectors (Addgene) expressing Luciferase or β-Galactosidase ...
-
bioRxiv - Immunology 2021Quote: ... The bacterial expression construct for full-length SARS-CoV-2 nucleocapsid was a gift from Nicolas Fawzi (Addgene plasmid # 157867 ...
-
bioRxiv - Immunology 2021Quote: ... The bacterial expression construct for full-length SARS-CoV-2 nucleocapsid was a gift from Nicolas Fawzi (Addgene plasmid # 157867; http://n2t.net/addgene:157867; RRID:Addgene_157867)69 ...
-
bioRxiv - Microbiology 2021Quote: The plasmid encoding SARS-CoV-2 S HexaPro was a gift from Jason McLellan (Addgene plasmid # 154754; http://n2t.net/addgene:154754; RRID:Addgene_154754). This construct has been modified to include a cleavage site substitution as well as six prolines for stability (35) ...
-
bioRxiv - Cell Biology 2021Quote: ... These parental BV2 or BV2-Cas9 cells were transduced for 2 days with pXPR_011 expressing eGFP (Addgene; 59702) and a short guide RNA (sgRNA ...
-
bioRxiv - Neuroscience 2022Quote: ... we co-electroporated animals at stage 46-47 with pGP-CMV-GCaMP6f (2 mg/mL, Addgene plasmid # 40755) and CMV-turboRFP (1mg/ml) ...
-
bioRxiv - Cancer Biology 2022Quote: ... SCD ORF was cloned in pLenti PGK Puro DEST 5W(w529-2) (gift from Eric Campeau & Paul Kaufman73; Addgene plasmid #19068; http://n2t.net/addgene:19068 ; RRID:Addgene_19068). FLT3-WT and FLT3-ITD ORFs were cloned in pLEX_307 (gift from David Root (Addgene plasmid #41392 ...
-
bioRxiv - Cell Biology 2022Quote: ... CRISPR vector pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766 ; http://n2t.net/addgene:58766 ; RRID:Addgene_58766) (101) ...
-
bioRxiv - Neuroscience 2020Quote: ... from pBS-KS-attB2-SA(0/1/2)-T2A-LexA::QFAD-Hsp70 plasmids (Addgene #62947, #62948 and #62949) (Diao et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... for imaging hippocampal pyramidal cells or pAAV-mDlx-GCaMP6f-Fishell-2 (a gift from Gordon Fishell, Addgene plasmid # 83899; http://n2t.net/addgene:83899; RRID:Addgene_83899) (88 ...
-
bioRxiv - Microbiology 2021Quote: ... and pLenti CMV GFP Neo (657-2) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17447). Expression plasmids SARS2-S2’-AA ...
-
bioRxiv - Neuroscience 2021Quote: ... The pCMV14-3X-Flag-SARS-CoV-2 S plasmid was a gift from Zhaohui Qian (Addgene plasmid # 145780; http://n2t.net/addgene:145780; RRID:Addgene_145780) 38 ...
-
bioRxiv - Immunology 2020Quote: ... The vector pEQ276 (encoding CMV IE1 and 2 genes) was a gift from Adam Geballe (Addgene plasmid #83945)67 ...
-
bioRxiv - Neuroscience 2021Quote: ... The visual cortex was injected with a total of 2–3 μl of virus solution (1e13 GC/ml) containing AAV9-Syn-GCaMP6s.WPRE.SV40 (Penn Vector Core or Addgene) through a beveled glass micropipette (tip size 10–20 μm diameter ...
-
bioRxiv - Neuroscience 2021Quote: AAV1/2.hSyn-GFP particles were generated by co-transfection of HEK293T cells with AAV2/1 (Addgene 112862), AAV2/2 (Addgene 104963) ...
-
bioRxiv - Neuroscience 2021Quote: ... mEos3.2-Homer1-N-18 was a gift from Michael Davidson (Addgene plasmid # 57461 ; http://n2t.net/addgene:57461; RRID:Addgene_57461). CMV::SypHy A4 was a gift from Leon Lagnado (Addgene plasmid # 24478 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 μg of total plasmid DNA/well were used in appropriate combinations of the plasmids: pLVX-puro (Addgene), pLVX-puro-TRIM67-Flag ...
-
bioRxiv - Cell Biology 2020Quote: ... dlg-1::mCherry and ebp-2::egfp vectors were cloned using Gibson assembly and vector pJJR82 (Addgene #75027) (Gibson et al. ...
-
bioRxiv - Genomics 2020Quote: FUS-/- cells were generated by transient transfection of U-2 OS cells with pX459 (v2, Addgene plasmid #62988) vectors(Ran et al. ...
-
bioRxiv - Immunology 2020Quote: ... pGBW-m4134096 encoding for SARS-CoV-2 M protein was a gift from Ginkgo Bioworks (Addgene plasmid #152039).
-
bioRxiv - Cell Biology 2022Quote: ... pEGFP-ZO-2 was a gift from Marius Sudol (Addgene plasmid # 27422; http://n2t.net/addgene: 27422; RRID: Addgene_27422) (Oka et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... YAP–HaloTag CRISPR knock-in U-2 OS cells were transfected with pEGFP-C3-Lats1 (Addgene plasmid # 19053) or pEGFP C3-Mst2 (Addgene plasmid # 19056) ...
-
bioRxiv - Microbiology 2022Quote: ... pGBW-m4252984 (SARS-CoV-2 E [envelope]) was a gift from Ginkgo Bioworks (Addgene plasmid #153898; http://n2t.net/addgene:153898; RRID:Addgene_153898). MLV-gag/pol ...
-
bioRxiv - Molecular Biology 2022Quote: All engineered SARS-CoV-2 S variant ectodomains were designed based on the HexaPro gene (Addgene plasmid #154754) containing stabilizing proline mutations at positions F817P ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were transfected with either (G4C2)92 and (G4C2)2 lentiviral transfer plasmids along with PAX (Addgene #12260) and VSV-G (Addgene #12259 ...
-
bioRxiv - Microbiology 2024Quote: ... The plasmid pcDNA3.1 SARS-CoV-2 S D614G was a gift from Jeremy Luban (Addgene plasmid # 158075; http://n2t.net/addgene:158075; RRID:Addgene_158075). The RBD amino acid sequence 328-537 encoded in this plasmid is identical to the sequence of RBD that we studied here ...